Background: Aniridia is a rare developmental eye disorder characterized by complete or partial iris hypoplasia often accompanied with other ocular changes that affect the cornea, anterior chamber, lens, retina, and optic nerve. Most cases of aniridia are inherited with an autosomal dominant mode of inheritance caused by PAX6 mutations or deletions. To reveal the underlying genetic defect in a four-generation Iranian family with aniridia, we carried out a genetic screening of PAX6.
Methods: Complete ophthalmic examinations were performed for available affected family members. All PAX6 exons and their flanking regions were sequenced for affected individuals. Candidate variation was screened for segregation in the pedigree by Sanger sequencing. Bioinformatics prediction was done to evaluate the deleterious effects of the mutation on protein product. Real-time PCR was used to investigate the impact of the variant on PAX6 mRNA expression.
Results: All patients were diagnosed with isolated aniridia associated with variable phenotypic features including retinal detachment. A novel heterozygous deletion c.320_348delTGTCCGAGGGGGTCTGTACCAACGATAAC (p.Leu107HisfsX16) on PAX6 gene was detected. Decreased mRNA level of PAX6 in the affected individuals indicated that the mutation caused nonsense-mediated mRNA decay (NMD).
Conclusions: To the best of our knowledge, it is the first report on the genetics of aniridia in Iran. Segregation analysis, bioinformatics prediction and confirmation of NMD, all support the proposition that the novel observed PAX6 mutation is the cause of aniridia in the pedigree. Retinal detachment in some of the affected members, which is a rare reported phenotypic feature of aniridia patients, may be associated with this mutation. 相似文献
Background: There are some unique epidemiological characteristics of esophageal cancer in Iran. The objective of this study was finding the association between tobacco, substance and alcohol using with the risk of esophageal cancer in North Khorasan, Iran.
Methods: This Case-Control study was carried out on 96 patients with esophageal cancer and 187 controls. Controls were matched to cases by age and sex. Data were collected through structured interview. Data were analyzed by using chi-square test, T-test and logistic regression, in Stata software version 12.
Results: Our findings show Hookah smoking [OR = 6.1(CI95%:1.2–13.1)] and opium consumption [OR = 2.1(CI95%:1.2–3.5)] were associated with esophageal cancer. Cigarette and pipe smoking, age of onset of smoking, duration of smoking, number of smoking per day, leaving history of smoking, years of leaving smoking, drug withdrawal, number of times of drug withdrawal, a history of drug relapse, alcohol consumption and alcohol dose–response were not related to esophageal cancer.
Conclusion: According to our results, hookah smoking and opium consumption enhance the risk of esophageal cancer in North Khorasan of Iran. We suggest appropriate planning to prevent the esophageal cancer in this district. 相似文献
Iatrogenic injury of the Profunda Femoris Artery (PFA) at time of hip fixation surgery can increase morbidity and mortality and prolong the hospital stay. This is an injury that tends to pass unnoticed as a cause of postoperative deterioration despite being frequently reported in the literature. Our study aims to describe the anatomy of the PFA in relation to the medial femoral cortex with specific emphasis on its orientation relative to the position of a sliding hip screw side plate construct. By doing so we are able to present clear guidance to orthopaedic surgeons on how to avoid iatrogenic PFA injury at the time of hip fracture fixation.
Methods
Using Computed Tomography Angiographic (CTA) studies, the course of the PFA in relation to the medial femoral cortex was traced in 44 patients (28 males and 16 females) with mean age of 65.6 years. Coronal and axial CT sections were cross-linked to specify the position of the PFA at 1?cm intervals.
Results
The course of the artery could be divided into three parts relative to a fixed reference point. Proximal and distal parts of the artery were in a safer position in comparison to the middle part of the artery that was found very close to the femoral cortex and along the coronal axis of the femur (mean angle 2.9° from the femoral coronal axis and 13.8?mm from the medial femoral cortex). Using the commercially available side plate constructs, this part of the artery corresponded to the distal part of the plate (third and fourth holes).
Conclusion
Special attention needs to be practiced by the operating surgeon while drilling into the third and fourth holes of the side plate. 相似文献
Arsenic (As) and cadmium (Cd) have recently emerged as major health concerns owing to their strong association with diabetes mellitus (DM). We aimed to investigate the heavy metals exposure towards incidence of DM at various enzymatic and hormonal levels. Additionally, association of As and Cd with Zinc (Zn, essential metal) was also evaluated. Spot urine samples were collected to assess As, Cd and Zn through ICP-OES. Serum was analyzed by assay method for fasting blood glucose, liver and renal function biomarkers. ELISA was performed to investigate the impact of heavy metals on HbA1c, α-amylase, DPP-IV, IGF-1, leptin, GSH, MDA, SOD, HDL, FFA, TG and interleukin (IL)-6. Association of heavy metals with DM was measured by odds ratio (OR) and level of significance was assessed by Chi-squared test. Unpaired student's t-test was used to compare DM-associated risk factors in heavy metals-exposed and unexposed participants. As and Cd were detectable in 75.4% and 83% participants with mean concentration of 75.5 ppb and 54.5 ppb, respectively. For As exposure, OR in the third quartile was maximum ie 1.34 (95% CI, 0.80 to 2.23), however the result was not statistically significant (P > .05). For Cd exposure, OR in the fourth quartile was considerably high, 1.62 (95% CI, 1.00 to 2.61), with a significant probability value (P < .05). Urinary Cd was negatively associated with Zn. As and Cd exposure increases the incidence of DM in the general population. Impaired hormonal and enzymatic levels in diabetic and non-diabetic exposed participants reflect the multiple organ damage by heavy metal exposure. 相似文献
Thirteen cases of primary appendicular adenocarcinoma are reported. This rare tumour usually presents as acute appendicitis. The correct diagnosis is rarely entertained before or during surgery. The main treatment choice lies between appendicectomy alone and appendicectomy followed by right hemicolectomy. There are anatomical reasons for advising the latter and survival figures from the literature tend to support this preference. The cases reported here indicate that in the period 1972-1984, in the North West Region, there was a slight preference for appendicectomy alone. The additional procedure of right hemicolectomy did not confer any clear-cut survival advantage. 相似文献
OBJECTIVES: To characterise mycobacterial clinical isolates based on amplification of the rpoB gene. SETTING: One hundred and thirty-five mycobacterial isolates cultured from suspected pulmonary tuberculosis (TB) patients were identified phenotypically. Molecular characterisation of the isolates was performed based on amplification of the rpoB gene, using duplex polymerase chain reaction (DPCR), PCR-restriction fragment length polymorphism (RFLP) and nested PCR-based sequence analysis techniques. RESULTS: The DPCR assay identified 129 of 135 (95.5%) clinical isolates as Mycobacterium tuberculosis complex species. Restriction enzyme analysis of the rpoB PCR product using Hind II identified 134 of the 135 (99.3%) isolates as M. tuberculosis complex, while nested PCR sequence analysis of the rpoB gene identified 133/133 examined isolates (100%) as M. tuberculosis species. No mycobacteria other than M. tuberculosis (MOTT) were detected among the studied isolates. CONCLUSION: DPCR, PCR/RFLP Hind II and nested PCR sequence analysis of the rpoB gene techniques showed comparable efficiency in the characterisation of Mycobacterium isolates. Nested PCR sequence analysis of the rpoB gene was superior to PCR/RFLP for characterisation of suspected M. tuberculosis isolates, while the DPCR technique showed less sensitivity. As PCR-RFLP requires less sophisticated laboratory facilities than nested PCR sequence analysis, it would be more appropriate to be adopted for accurate characterisation of mycobacteria in countries with a weak infrastructure. 相似文献
OBJECTIVE: Given the associated risk of general anesthesia in elderly patients with cardiovascular disease, the authors set out to determine the feasibility of transcanal cochlear implantation under local anesthesia with monitored anesthesia care. METHODS: A 70-year-old man with a history of coronary artery bypass grafting, diabetes mellitus, and an American Society of Anesthesiologists Class III cardiac status underwent cochlear implantation under local with monitored anesthesia care. RESULT: With the described technique and regimen of intravenous remifentanil and dexmedetomidine, the patient tolerated the 60-minute procedure without tachycardia, hyper- or hypotension, or cardiac ischemia. CONCLUSION: Cochlear implantation using the pericanal electrode technique performed under local anesthesia with monitored anesthesia care is possible in patients at risk for undergoing general anesthesia for cochlear implantation. 相似文献
We present an unusual case of a young female patient presenting with bilateral choanal atresia, which was probably acquired, associated with nasal and paranasal sinus hypoplasia and hypogammaglobulinaemia. 相似文献
Summary: The effect of gestational age on neonatal ictal and interictal durations has not been investigated. Sixty-eight neonates with 644 electrographic seizures were identified retrospectively. Thirty-five full-term (FT) neonates were compared with 33 preterm (PT) neonates. Eighteen older preterm infants (OPT) [>31 weeks estimated gestational age (EGA)] were also compared with 15 young preterm infants (YPT) of ≤31 weeks EGA. Ictal/ interictal durations were calculated for the total cohort with and without status epilepticus (SE). Statistical analyses were two-tailed t tests, chi-square calculations, and one-way analysis of variance (ANOVA) with Duncan's multiple-range test. Eleven of 35 (33%) FT had SE as compared with 3 of 33 (9%) PT (chi-square = 7.8, p < 0.05). The mean ictal duration was 14.2 min for FT infants as compared with 3.1 min for PT infants (p < 0.01); only borderline differences were noted after those with SE were excluded. Interictal durations were longer for OPT than YPT (p < 0.05). By ANOVA and Duncan's multiple-range tests, group differences included longer mean ictal durations for FT infants as compared with OPT infants (p = 0.06, ANOVA; p < 0.05, Duncan's), and longer mean interictal durations for FT infants versus OPT and OPT versus YPT (p = 0.02, ANOVA; p < 0.05, Duncan's). More developed neuronal networks result in longer ictal durations in FT than in PT neonates, including FT infants with SE. Inhibitory networks responsible for longer interictal periods are more dominant in OPT infants than in YPT infants, reflecting maturational changes that suppress seizure activity during the latter part of the third trimester before the infant reaches an FT corrected age. 相似文献