Anaplastic thyroid carcinoma (ATC) is an aggressive thyroid malignancy with high mortality rate. This malignancy arises in thyroid follicular cells either denovo or with an associated differentiated thyroid carcinoma component. Clinically, it usually presents as a rapidly enlarging mass, pain and locally compressive symptoms. Histopathologic variability and heterogeneity often pose diagnostic challenges, especially in scant and paucicellular specimens. This article describes the clinical, histopathologic and molecular features of ATC and also addresses the associated diagnostic limitations and challenges. 相似文献
Background: Aniridia is a rare developmental eye disorder characterized by complete or partial iris hypoplasia often accompanied with other ocular changes that affect the cornea, anterior chamber, lens, retina, and optic nerve. Most cases of aniridia are inherited with an autosomal dominant mode of inheritance caused by PAX6 mutations or deletions. To reveal the underlying genetic defect in a four-generation Iranian family with aniridia, we carried out a genetic screening of PAX6.
Methods: Complete ophthalmic examinations were performed for available affected family members. All PAX6 exons and their flanking regions were sequenced for affected individuals. Candidate variation was screened for segregation in the pedigree by Sanger sequencing. Bioinformatics prediction was done to evaluate the deleterious effects of the mutation on protein product. Real-time PCR was used to investigate the impact of the variant on PAX6 mRNA expression.
Results: All patients were diagnosed with isolated aniridia associated with variable phenotypic features including retinal detachment. A novel heterozygous deletion c.320_348delTGTCCGAGGGGGTCTGTACCAACGATAAC (p.Leu107HisfsX16) on PAX6 gene was detected. Decreased mRNA level of PAX6 in the affected individuals indicated that the mutation caused nonsense-mediated mRNA decay (NMD).
Conclusions: To the best of our knowledge, it is the first report on the genetics of aniridia in Iran. Segregation analysis, bioinformatics prediction and confirmation of NMD, all support the proposition that the novel observed PAX6 mutation is the cause of aniridia in the pedigree. Retinal detachment in some of the affected members, which is a rare reported phenotypic feature of aniridia patients, may be associated with this mutation. 相似文献
Magnetic field generated by neuronal activity could alter magnetic resonance imaging (MRI) signals but detection of such signal is under debate. Previous researches proposed that magnitude signal change is below current detectable level, but phase signal change (PSC) may be measurable with current MRI systems. Optimal imaging parameters like echo time, voxel size and external field direction, could increase the probability of detection of this small signal change. We simulate a voxel of cortical column to determine effect of such parameters on PSC signal. We extended a laminar network model for somatosensory cortex to find neuronal current in each segment of pyramidal neurons (PN). 60,000 PNs of simulated network were positioned randomly in a voxel. Biot–savart law applied to calculate neuronal magnetic field and additional phase. The procedure repeated for eleven neuronal arrangements in the voxel. PSC signal variation with the echo time and voxel size was assessed. The simulated results show that PSC signal increases with echo time, especially 100/80 ms after stimulus for gradient echo/spin echo sequence. It can be up to 0.1 mrad for echo time = 175 ms and voxel size = 1.48 × 1.48 × 2.18 mm3. With echo time less than 25 ms after stimulus, it was just acquired effects of physiological noise on PSC signal. The absolute value of the signal increased with decrease of voxel size, but its components had complex variation. External field orthogonal to local surface of cortex maximizes the signal. Expected PSC signal for tactile detection in the somatosensory cortex increase with echo time and have no oscillation. 相似文献
Brucellosis is a world prevalent endemic illness that is transmitted from domestic animals to humans. Brucella spp. exploits urease for survival in the harsh conditions of stomach during the gastrointestinal infection. In this study, we examined the immune response and the protection elicited by using recombinant Brucella urease (rUrease) vaccination in BALB/c mice. The urease gene was cloned in pET28a and the resulting recombinant protein was employed as subunit vaccine. Recombinant protein was administered subcutaneously and intraperitoneally. Dosage reduction was observed with subcutaneous (SC) vaccination when compared with intraperitoneal (IP) vaccination. rUrease induced mixed Th1–Th2 immune responses with high titers of specific IgG1 and IgG2a. In lymphocyte proliferation assay, splenocytes from IP and SC‐vaccinated mice displayed a strong recall proliferative response with high amounts of IL‐4, IL‐12 and IFN‐γ production. Vaccinated mice were challenged with virulent Brucella melitensis, B. abortus and B. suis. The SC vaccination route exhibited a higher degree of protection than IP vaccination (p value ≤ 0.05). Altogether, our results indicated that rUrease could be a useful antigen candidate for the development of subunit vaccines against brucellosis. 相似文献
Farnesyltransferase (FTase) is one of the prenyltransferase family enzymes that catalyse the transfer of 15-membered isoprenoid (farnesyl) moiety to the cysteine of CAAX motif-containing proteins including Rho and Ras family of G proteins. Inhibitors of FTase act as drugs for cancer, malaria, progeria and other diseases. In the present investigation, we have developed two structure-based pharmacophore models from protein–ligand complex (3E33 and 3E37) obtained from the protein data bank. Molecular dynamics (MD) simulations were performed on the complexes, and different conformers of the same complex were generated. These conformers were undergone protein–ligand interaction fingerprint (PLIF) analysis, and the fingerprint bits have been used for structure-based pharmacophore model development. The PLIF results showed that Lys164, Tyr166, TrpB106 and TyrB361 are the major interacting residues in both the complexes. The RMSD and RMSF analyses on the MD-simulated systems showed that the absence of FPP in the complex 3E37 has significant effect in the conformational changes of the ligands. During this conformational change, some interactions between the protein and the ligands are lost, but regained after some simulations (after 2 ns). The structure-based pharmacophore models showed that the hydrophobic and acceptor contours are predominantly present in the models. The pharmacophore models were validated using reference compounds, which significantly identified as HITs with smaller RMSD values. The developed structure-based pharmacophore models are significant, and the methodology used in this study is novel from the existing methods (the original X-ray crystallographic coordination of the ligands is used for the model building). In our study, along with the original coordination of the ligand, different conformers of the same complex (protein–ligand) are used. It concluded that the developed methodology is significant for the virtual screening of novel molecules on different targets. 相似文献
This paper takes a somewhat slant perspective on flourishing and care in the context of suffering, death and dying, arguing that care in this context consists principally of ‘acts of work and courage that enable flourishing’. Starting with the perception that individuals, society and health care professionals have become dulled to death and the process of dying in Western advanced health systems, it suggests that for flourishing to occur, both of these aspects of life need to be faced more directly. The last days of life need to be ‘undulled’. Reflections upon the experiences of the author as carer and daughter in the face of her mother’s experience of death are used as basis for making suggestions about how care systems and professionals might better assist people in dealing with ‘the most grown up thing’ humans ever do, which is to die. 相似文献