A novel PAX6 mutation causes congenital aniridia with or without retinal detachment

Background: Aniridia is a rare developmental eye disorder characterized by complete or partial iris hypoplasia often accompanied with other ocular changes that affect the cornea, anterior chamber, lens, retina, and optic nerve. Most cases of aniridia are inherited with an autosomal dominant mode of inheritance caused by PAX6 mutations or deletions. To reveal the underlying genetic defect in a four-generation Iranian family with aniridia, we carried out a genetic screening of PAX6.

Methods: Complete ophthalmic examinations were performed for available affected family members. All PAX6 exons and their flanking regions were sequenced for affected individuals. Candidate variation was screened for segregation in the pedigree by Sanger sequencing. Bioinformatics prediction was done to evaluate the deleterious effects of the mutation on protein product. Real-time PCR was used to investigate the impact of the variant on PAX6 mRNA expression.

Results: All patients were diagnosed with isolated aniridia associated with variable phenotypic features including retinal detachment. A novel heterozygous deletion c.320_348delTGTCCGAGGGGGTCTGTACCAACGATAAC (p.Leu107HisfsX16) on PAX6 gene was detected. Decreased mRNA level of PAX6 in the affected individuals indicated that the mutation caused nonsense-mediated mRNA decay (NMD).

Conclusions: To the best of our knowledge, it is the first report on the genetics of aniridia in Iran. Segregation analysis, bioinformatics prediction and confirmation of NMD, all support the proposition that the novel observed PAX6 mutation is the cause of aniridia in the pedigree. Retinal detachment in some of the affected members, which is a rare reported phenotypic feature of aniridia patients, may be associated with this mutation.     

Vaccine-associated paralytic poliomyelitis in a patient with MHC class II deficiency.

Vaccine-associated paralytic poliomyelitis (VAPP) is a rare complication of oral polio vaccine. We describe a fatal case of VAPP in an 8-month-old boy with Major Histocompatibility Class II deficiency. The isolated poliovirus was a Sabin type 2-type 1 recombinant that showed 1.4% VP1 divergence from Sabin type 2.     

Effects of diode low-level laser therapy on healing of tooth extraction sockets: a histopathological study in diabetic rats

Lasers in Medical Science - Diabetes mellitus is mostly interrelated to deficiency in wound healing. Low-level laser therapy has been shown to exert reliable effects on the acceleration of wound...     

A randomized,double-blind placebo-controlled add-on trial to assess the efficacy,safety, and anti-atherogenic effect of spirulina platensis in patients with inadequately controlled type 2 diabetes mellitus

The efficacy of spirulina platensis (S. platensis) as an add-on therapy to metformin and its effect on atherogenic keys in patients with uncontrolled Type 2 Diabetes Mellitus (T2DM) was evaluated. Sixty patients were randomly assigned to S. platensis (2 g/day) or placebo group for three months while continuing metformin as their usual treatment. The efficacy of S. platensis was determined using the pre- and post-intervention HbA1c levels (primary outcome) as well as tracking FBS and lipid profiles levels (TC, LDL-C, TG, and HDL-C) as secondary outcomes at the different treatment time points (0,30,60,90 days). During the three–month intervention period, supplementation with S. platensis resulted in a significant lowering of HbA1c (↓1.43, p < 0.001) and FBS (↓ 24.94 mg/dL, p < 001) levels. Mean TG in the intervention group was found to be significantly lower in the intervention group than in controls (p < 0.001). Total cholesterol (TC) and its fraction, LDL-C, exhibited a fall (↓41.36 mg/dL and ↓38.4 mg/dL, respectively; p < 0.001) coupled with a marginal increase in the level of HDL-C (↑3 mg/dL; p < 0.001). Add-on therapy with S. platensis was superior to metformin regarding long-term glucose regulation and controlling blood glucose levels of subjects with T2DM. Also, as a functional supplement, S. platensis has a beneficial effect on atherogenic keys (TG and HDL-C) with no adverse events.     

Establishment of a formal program for retinoblastoma: Feasibility of clinical coordination across borders and impact on outcome

Retinoblastoma is an ocular tumor that occurs in young children, in either heritable or sporadic manner. The relative rarity of retinoblastoma, and the need for expensive equipment, anesthesia, and pediatric ophthalmologic expertise, are barriers for effective treatment in developing countries. Also, with an average age‐adjusted incidence of two to five cases per million children, patient number limits development of local expertise in countries with small populations. Lebanon is a small country with a population of approximately 4.5 million. In 2012, a comprehensive retinoblastoma program was formalized at the Children's Cancer Institute (CCI) at the American University of Beirut Medical Center, and resources were allocated for efficient interdisciplinary coordination to attract patients from neighboring countries such as Syria and Iraq, where such specialized therapy is also lacking. Through this program, care was coordinated across hospitals and borders such that patients would receive scheduled chemotherapy at their institution, and monthly retinal examinations and focal laser therapy at the CCI in Lebanon. Our results show the feasibility of successful collaboration across borders, with excellent patient and physician adherence to treatment plans. This was accompanied by an increase in patient referrals, which enables continued expertise development. However, the majority of patients presented with advanced intraocular disease, necessitating enucleation in 90% of eyes in unilateral cases, and more than 50% of eyes in bilateral cases. Future efforts need to focus on expanding the program that reaches to additional hospitals in both countries, and promoting early diagnosis, for further improvement of globe salvage rates.     

Evaluation of the effect of cognitive behavioral therapy on tocophobia: A systematic review and meta-analysis

Non-medical approaches including cognitive behavioral therapy (CBT) have been proposed for the management of tocophobia. A new method of performing CBT is through internet. The aim of this systematic review and meta-analysis was to evaluate the effect of internet-based and traditional CBT on tocophobia. A literature search was conducted on qualitative and quantitative articles from 2000 to 2019 in Pubmed, Scopus, Web of Science and Cochrane databases using search terms referring to tocophobia and CBT. Identified articles were screened in two steps; 1) title and abstract and 2) full text screening. The quality of the quantitative and qualitative studies was assessed using the quality criteria proposed by the Cochrane Collaboration and Jonna Briggs Institute (JBI) checklist respectively. Out of the 382 relevant studies, 9 studies were eligible for the review. A high level of heterogeneity was observed in the studies (I² = 94%, P < 0.001). The meta-analysis showed that both internet-based, and traditional CBT were effective in reducing tocophobia. CBT was more effective in interventions in the Middle Eastern compared to European countries. More than five CBT sessions could significantly reduce tocophobia. Healthcare providers and midwives should have basic knowledge on physiological interventions to reduce tocophobia.