A novel PAX6 mutation causes congenital aniridia with or without retinal detachment

Background: Aniridia is a rare developmental eye disorder characterized by complete or partial iris hypoplasia often accompanied with other ocular changes that affect the cornea, anterior chamber, lens, retina, and optic nerve. Most cases of aniridia are inherited with an autosomal dominant mode of inheritance caused by PAX6 mutations or deletions. To reveal the underlying genetic defect in a four-generation Iranian family with aniridia, we carried out a genetic screening of PAX6.

Methods: Complete ophthalmic examinations were performed for available affected family members. All PAX6 exons and their flanking regions were sequenced for affected individuals. Candidate variation was screened for segregation in the pedigree by Sanger sequencing. Bioinformatics prediction was done to evaluate the deleterious effects of the mutation on protein product. Real-time PCR was used to investigate the impact of the variant on PAX6 mRNA expression.

Results: All patients were diagnosed with isolated aniridia associated with variable phenotypic features including retinal detachment. A novel heterozygous deletion c.320_348delTGTCCGAGGGGGTCTGTACCAACGATAAC (p.Leu107HisfsX16) on PAX6 gene was detected. Decreased mRNA level of PAX6 in the affected individuals indicated that the mutation caused nonsense-mediated mRNA decay (NMD).

Conclusions: To the best of our knowledge, it is the first report on the genetics of aniridia in Iran. Segregation analysis, bioinformatics prediction and confirmation of NMD, all support the proposition that the novel observed PAX6 mutation is the cause of aniridia in the pedigree. Retinal detachment in some of the affected members, which is a rare reported phenotypic feature of aniridia patients, may be associated with this mutation.     

An overview of existing mesothelioma registries worldwide,and the need for a US Registry

The association between asbestos exposure, mainly in occupational settings, and malignant mesothelioma has been well established; this has prompted several countries to establish mesothelioma epidemiologic surveillance programs often at the request of national agencies. This review compares currently existing mesothelioma registries worldwide to develop a concept model for a US real-time case capture mesothelioma registry. Five countries were identified with a mesothelioma specific registry, including Italy, France, UK, Australia, and South Korea. All, except the UK, used interviews to collect exposure data. Linkage with the national death index was available or was in future plans for all registries. The registries have limited information on treatment, quality of life, and other patient-centered outcomes such as symptoms and pain management. To thoroughly collect exposure data, “real-time” enrollment is preferable; to maximize the capture of mesothelioma cases, optimal coverage, and a simplified consent process are needed.     

Tobacco consumption,opium use,alcohol drinking and the risk of esophageal cancer in North Khorasan,Iran

Background: There are some unique epidemiological characteristics of esophageal cancer in Iran. The objective of this study was finding the association between tobacco, substance and alcohol using with the risk of esophageal cancer in North Khorasan, Iran.

Methods: This Case-Control study was carried out on 96 patients with esophageal cancer and 187 controls. Controls were matched to cases by age and sex. Data were collected through structured interview. Data were analyzed by using chi-square test, T-test and logistic regression, in Stata software version 12.

Results: Our findings show Hookah smoking [OR = 6.1(CI_95%:1.2–13.1)] and opium consumption [OR = 2.1(CI_95%:1.2–3.5)] were associated with esophageal cancer. Cigarette and pipe smoking, age of onset of smoking, duration of smoking, number of smoking per day, leaving history of smoking, years of leaving smoking, drug withdrawal, number of times of drug withdrawal, a history of drug relapse, alcohol consumption and alcohol dose–response were not related to esophageal cancer.

Conclusion: According to our results, hookah smoking and opium consumption enhance the risk of esophageal cancer in North Khorasan of Iran. We suggest appropriate planning to prevent the esophageal cancer in this district.     

Identification of the medial femoral safe zone for drilling during dynamic hip screw side plate fixation: A CT angiogram tracing of the profunda femoris artery

Objectives

Iatrogenic injury of the Profunda Femoris Artery (PFA) at time of hip fixation surgery can increase morbidity and mortality and prolong the hospital stay. This is an injury that tends to pass unnoticed as a cause of postoperative deterioration despite being frequently reported in the literature. Our study aims to describe the anatomy of the PFA in relation to the medial femoral cortex with specific emphasis on its orientation relative to the position of a sliding hip screw side plate construct. By doing so we are able to present clear guidance to orthopaedic surgeons on how to avoid iatrogenic PFA injury at the time of hip fracture fixation.

COVID-19 and hematology findings based on the current evidences: A puzzle with many missing pieces

In December 2019, a new type of coronavirus was detected for the first time in Wuhan, Hubei Province, China. According to the reported data, the emerging coronavirus has spread worldwide, infecting more than fifty-seven million individuals, leading to more than one million deaths. The current study aimed to review and discuss the hematological findings of COVID-19. Laboratory changes and hematologic abnormalities have been reported repeatedly in COVID-19 patients. WBC count and peripheral blood lymphocytes are normal or slightly reduced while these indicators may change with the progression of the disease. In addition, several studies demonstrated that decreased hemoglobin levels in COVID-19 patients were associated with the severity of the disease. Moreover, thrombocytopenia, which is reported in 5%-40% of patients, is known to be associated with poor prognosis of the disease. COVID-19 can present with various hematologic manifestations. In this regard, accurate evaluation of laboratory indicators at the beginning and during COVID-19 can help physicians to adjust appropriate treatment and provide special and prompt care for those in need.