A novel PAX6 mutation causes congenital aniridia with or without retinal detachment

Background: Aniridia is a rare developmental eye disorder characterized by complete or partial iris hypoplasia often accompanied with other ocular changes that affect the cornea, anterior chamber, lens, retina, and optic nerve. Most cases of aniridia are inherited with an autosomal dominant mode of inheritance caused by PAX6 mutations or deletions. To reveal the underlying genetic defect in a four-generation Iranian family with aniridia, we carried out a genetic screening of PAX6.

Methods: Complete ophthalmic examinations were performed for available affected family members. All PAX6 exons and their flanking regions were sequenced for affected individuals. Candidate variation was screened for segregation in the pedigree by Sanger sequencing. Bioinformatics prediction was done to evaluate the deleterious effects of the mutation on protein product. Real-time PCR was used to investigate the impact of the variant on PAX6 mRNA expression.

Results: All patients were diagnosed with isolated aniridia associated with variable phenotypic features including retinal detachment. A novel heterozygous deletion c.320_348delTGTCCGAGGGGGTCTGTACCAACGATAAC (p.Leu107HisfsX16) on PAX6 gene was detected. Decreased mRNA level of PAX6 in the affected individuals indicated that the mutation caused nonsense-mediated mRNA decay (NMD).

Conclusions: To the best of our knowledge, it is the first report on the genetics of aniridia in Iran. Segregation analysis, bioinformatics prediction and confirmation of NMD, all support the proposition that the novel observed PAX6 mutation is the cause of aniridia in the pedigree. Retinal detachment in some of the affected members, which is a rare reported phenotypic feature of aniridia patients, may be associated with this mutation.     

The chondrocyte channelome: A narrative review

Chondrocytes are the main cells in the extracellular matrix (ECM) of articular cartilage and possess a highly differentiated phenotype that is the hallmark of the unique physiological functions of this specialised load-bearing connective tissue. The plasma membrane of articular chondrocytes contains a rich and diverse complement of membrane proteins, known as the membranome, which defines the cell surface phenotype of the cells. The membranome is a key target of pharmacological agents and is important for chondrocyte function. It includes channels, transporters, enzymes, receptors, and anchors for intracellular, cytoskeletal and ECM proteins and other macromolecular complexes. The chondrocyte channelome is a sub-compartment of the membranome and includes a complete set of ion channels and porins expressed in these cells. Many of these are multi-functional proteins with “moonlighting” roles, serving as channels, receptors and signalling components of larger molecular assemblies. The aim of this review is to summarise our current knowledge of the fundamental aspects of the chondrocyte channelome, discuss its relevance to cartilage biology and highlight its possible role in the pathogenesis of osteoarthritis (OA). Excessive and inappropriate mechanical loads, an inflammatory micro-environment, alternative splicing of channel components or accumulation of basic calcium phosphate crystals can result in an altered chondrocyte channelome impairing its function. Alterations in Ca²⁺ signalling may lead to defective synthesis of ECM macromolecules and aggravated catabolic responses in chondrocytes, which is an important and relatively unexplored aspect of the complex and poorly understood mechanism of OA development.     

Matrix Metalloproteinases 2 and 9 Polymorphism in Patients With Myeloproliferative Diseases: A STROBE-Compliant Observational Study

Chronic myeloproliferative disorders such as polycythemia vera (PV), essential thrombocytosis (ET), and idiopathic myelofibrosis arise from clonal proliferation of neoplastic stem cells in the bone marrow. Matrix metalloproteinases (MMPs) are a family of zinc-dependent endopeptidases that have potential to degrade all types of extracellular matrix (ECM) and also play a role in remodeling of the ECM. It is known that MMPs play a role in bone marrow remodeling.The primary goal of our study is to explore the relationship between chronic myeloproliferative diseases and some of MMP gene polymorphisms. The demonstration of a relationship will help to understand whether these polymorphisms may be a potential early diagnosis marker of the diseases.Patients were selected from outpatient clinics of Turgut Ozal University Hospital, Ankara, Turkey, between December 2010 and May 2011. Twenty-eight patients that previously diagnosed and followed-up with PV, 17 with secondary polycythemia (SP), and 12 with ET were enrolled in the study, along with a control group of 22 healthy people.DNA was isolated from peripheral blood. Using polymerase chain reaction–restriction fragment length polymorphism method, MMP2 and MMP9 gene polymorphisms were analyzed with agarose gel electrophoresis. There was a statistically significant difference between the study groups and the control group in terms of Gln279Arg polymorphisms rates of MMP9. The highest MMP9 Gln279Arg polymorphism rate was observed in the ET group. But nobody from the control group had polymorphic MMP9. There was no statistically significant difference between the groups in terms of MMP2-735 C > T polymorphism rates.In conclusion, MMP9 gene Gln279Arg polymorphism was associated with ET, SP, and PV diseases. Hence, we believe that these gene polymorphisms may play a role in the mechanism of bone marrow fibrosis and may be a factor that increases the risk of thrombosis. Illumination of the molecular basis of the relationship between MMP-thrombosis and MMP-fibrosis provides a better understanding of the pathophysiology of PV and ET diseases and will allow new approaches to diagnosis and treatment.     

Estimation of phase signal change in neuronal current MRI for evoke response of tactile detection with realistic somatosensory laminar network model

Magnetic field generated by neuronal activity could alter magnetic resonance imaging (MRI) signals but detection of such signal is under debate. Previous researches proposed that magnitude signal change is below current detectable level, but phase signal change (PSC) may be measurable with current MRI systems. Optimal imaging parameters like echo time, voxel size and external field direction, could increase the probability of detection of this small signal change. We simulate a voxel of cortical column to determine effect of such parameters on PSC signal. We extended a laminar network model for somatosensory cortex to find neuronal current in each segment of pyramidal neurons (PN). 60,000 PNs of simulated network were positioned randomly in a voxel. Biot–savart law applied to calculate neuronal magnetic field and additional phase. The procedure repeated for eleven neuronal arrangements in the voxel. PSC signal variation with the echo time and voxel size was assessed. The simulated results show that PSC signal increases with echo time, especially 100/80 ms after stimulus for gradient echo/spin echo sequence. It can be up to 0.1 mrad for echo time = 175 ms and voxel size = 1.48 × 1.48 × 2.18 mm³. With echo time less than 25 ms after stimulus, it was just acquired effects of physiological noise on PSC signal. The absolute value of the signal increased with decrease of voxel size, but its components had complex variation. External field orthogonal to local surface of cortex maximizes the signal. Expected PSC signal for tactile detection in the somatosensory cortex increase with echo time and have no oscillation.     

Imaging in secondary tumors of the ovary

Abdominal Radiology - Metastatic involvement of the ovaries is not rare. The most common tumor types metastasizing to the ovaries, from non-gynecological organs, are breast, colorectal, gastric,...     

Intervention for arch obstruction after the Norwood procedure: Prevalence,associated factors,and practice variability

Objective

Arch obstruction after the Norwood procedure is common and contributes to mortality. We determined the prevalence, associated factors, and practice variability of arch reintervention and assessed whether arch reintervention is associated with mortality.