Familial renal carcinoma

Renal carcinoma developed in two or more members of nine families. Multiple generations were affected in five kindreds, and siblings in four. The median age at cancer diagnosis was a decade earlier than usual, and individual patients had bilateral or multifocal lesions; these are features of hereditary forms of diverse cancers. No patient had von Hippel-Lindau disease or other predisposing genetic syndromes. Karyotypes of the peripheral blood of nine persons showed no instance of a 3;8 chromosome translocation as recently reported in association with renal carcinoma in ten members of one family. The findings show that familial renal cancer is more common than previously reported in the literature.     

Polyorna virus adsorbs to specific sialyloligosaccharide receptors on erythrocytes

Hemagglutination by polyoma virus has been shown to require sialic acid residues on cell surface oligosaccharides. This report presents evidence which suggests that adsorbtion of polyoma virus to erythrocytes is not due simply to a nonspecific electrostatic interaction with negatively charged sialic acids but rather requires the presence of specific sialyloligosaccharide structures. Newcastle disease virus (NDV) neuraminidase hydrolyzes sialic acids in the sequences NeuAcα2,3Gal and NeuAcα2,8NeuAc. Erythrocytes treated with NDV lost 40% of their surface sialic acid, retained full hemagglutination by certain influenza viruses which also bind sialyloligosaccharides, and yet were not agglutinated by polyoma virus. Erythrocytes treated with Vibrio cholerae neuraminidase, which removes virtually all sialic acid, were no longer agglutinated by influenza virus or polyoma virus. Selective replacement of sialic acid on V. cholerae neuraminidase-treated cells with purified β-galactoside α-2,3-sialytransferase in the sequence NeuAcα2, 3Gal completely restored hemagglutination by polyoma virus. In contrast, replacement of sialic acid by other sialyitransferases in the sequences NeuAcα2,6Gal or NeuAcα2,6GalNAc does not restore hemagglutination by polyoma virus.     

Terminal sequences of Sindbis virus-specific nucleic acids: Identity in molecules synthesized in vertebrate and insect cells and characteristic properties of the replicative form RNA

The terminal sequences of the virus-specific nucleic acids synthesized in BHK vertebrate cells and in Aedes albopictus insect cells infected with the alphavirus Sindbis virus have been analyzed. The 26 S and 42 S plus-strand RNA molecules have the 5′-terminal sequences m⁷GpppAUAG and m⁷GpppAUAGGCGGCGUAGUACACAC, respectively. A 22 S replicative form (RF) RNA which contains an infectious 42 S plus-strand genome RNA molecule and a complementary 42 S negative-strand RNA accumulates in infected cells. The 5′-terminal sequence of the 42 S plus-strand RNA component of the RF is identical to that of the single-stranded plus-strand 42 S RNA molecule except for the absence of a 5′-terminal cap in the constituent of the RF RNA. The identification of a poly(U) sequence at the 5′-terminus of the 42 S minus strand RNA in our experiments is in accordance with earlier results obtained in other laboratories (Sawicki and Gomatos, 1976; Frey and Strauss, 1978). Analogous to our data concerning the structure of the RF RNA of the alphavirus Semliki Forest virus (Wengler et al., 1979) the 3′-terminus of the 42 S minus strand RNA component of the Sindbis virus-specific RF RNA is complementary to the 5′-terminus of the 42 S plus strand RNA molecule but in addition contains a 3′-terminal extra unpaired guanosine residue. The 3′-terminal sequence of the 42 S minus strand is strongly conserved between the two alphaviruses, Sindbis virus and Semliki Forest virus. The terminal sequences of the RF RNA synthesized in BHK and Aedes albopictus cells are identical. Analyses of the capped oligonucleotides derived from virus-specific single-stranded 42 S plus-strand RNA and from 26 S RNA strongly indicate that no base sequence differences exists between the corresponding molecules synthesized in either vertebrate or insect cells. Possible implications of these findings concerning the structure of alphavirus RF RNA and the synthesis of alphavirus-specific nucleic acids are discussed.     

In vivo and in vitro correlates of food allergy.

Sera of 86 patients clinically sensitive to foods were tested by passive sensitization of human and/or monkey lung (127 tests) and the radioallergosorbent test (RAST) (72 tests), using whole-food antigens; the results were compared with skin (prick) testing. Results of the prick test correlated with history in 76% of cases; lung sensitization correlated with history in 37% and with prick test in 57%; and RAST correlated with history in 54% and prick test in 72%. It is concluded that a very large percentage of adverse reactions to foods are IgE-mediated. The prick test is of use in diagnosis, particularly when combined with RAST; the lung sensitization test is technically impractical and not a reliable indicator. The best diagnostic method is careful history with food challenge and withdrawal and rechallenge; the latter is safe except in patients with a history of violent reaction.     

Specific high-affinity binding of 125I-labeled mouse interferon to interfevon resistant embryonal carcinoma cells in vitro

Multipotential mouse embryonal carcinoma cells are resistant to several biologic effects of mouse interferon: inhibition of viral multiplication and inhibition of cell division. Nevertheless using ¹²⁵I-labeled highly purified mouse interferon we have shown that these embryonal carcinoma cells express specific interferon receptors in similar number and of the same affinity as interferon sensitive differentiated embryonal carcinoma cells. Thus, mechanisms of interferon resistance are probably multiple: some cells are resistant because they lack specific binding sites for interferon (interferon resistant mouse L1210 cells) and other cells, as shown herein, are resistant to some of the effects of interferon despite binding of interferon to specific receptor sites. Furthermore, these binding sites may be considered functional, since interferon does induce an increase in 2-5A synthetase in these cells.     

Induction of endogenous murine retrovius by hydroxyurea and related compounds.

Hydroxyurea and two related compounds, carbamoyloxyurea and formamidoxime, induce endogenous retrovirus expression in AKR mouse embryo cells. Only the induction of ecotropic (N-tropic) virus was detected. The ability of each compound to induce shows a linear dose-response over a limited range of concentrations which correlate with the cytotoxicity of each of the compounds. The data suggest that these compounds may induce virus expression via damage to cellular DNA.     

Karyotypic evolution in Ph-positive chronic myeloid leukemia in relation to management and disease progression

In a prospective study of 32 patients with chronic myeloid leukemia the frequency of chromosome abnormalities in addition to the Philadelphia chromosome (Ph) increased when the disease progressed. Before metamorphosis, 10 patients (31%) had developed additional abnormalities. Such abnormalities were present in three of them at the time of diagnosis; in the other seven, they were detected late in the chronic phase. New clonal abnormalities heralded or accompanied a more malignant phase of the disorder, usually a blastic leukemia. During metamorphosis, 78% of the patients had additional abnormalities, which in 68% of these cases comprised at least one of +8, +22q- or i(17q). Clones with additional abnormalities disappeared in eight cases, either spontaneously or in association with cytostatic therapy during the chronic or blastic phase. Involvement of chromosome #8, usually in the form of a trisomy, was found in 7 of 12 patients treated with busulfan, but was not found in any of the 10 hydroxyurea-treated patients, of whom 8 were splenectomized early during the chronic phase. Cells from the spleen, obtained by fine needle aspiration or splenectomy were cytogenetically examined in 18 cases during the chronic phase, but abnormalities in addition to the Ph were noted in only one patient, who was examined in the late chronic phase. The same abnormalities were present in bone marrow cells of this patient.