Porcine reproductive and respiratory syndrome virus (PRRSV) and Mycoplasma hyopneumoniae (M. hyopneumoniae, Mhp) are two of the most common pathogens involved in the porcine respiratory disease complex (PRDC) resulting in significant economic losses worldwide. Vaccination is the most effective approach to disease prevention. Since PRRSV and Mhp co-infections are very common, an efficient dual vaccine against these pathogens is required for the global swine industry. Compared with traditional vaccines, multi-epitope vaccines have several advantages, they are comparatively easy to produce and construct, are chemically stable, and do not have an infectious potential. In this study, to develop a safe and effective vaccine, B cell and T cell epitopes of PRRSV-GP5, PRRSV-M, Mhp-P46, and Mhp-P65 protein had been screened to construct a recombinant epitope protein rEP-PM that has good hydrophilicity, strong antigenicity, and high surface accessibility, and each epitope is independent and complete. After immunization in mice, rEP-PM could induce the production of high levels of antibodies, and it had good immunoreactivity with anti-rEP-PM, anti-PRRSV, and anti-Mhp antibodies. The anti-rEP-PM antibody specifically recognizes proteins from PRRSV and Mhp. Moreover, rEP-PM induced a Th1-dominant cellular immune response in mice. Our results showed that the rEP-PM protein could be a potential candidate for the development of a safe and effective multi-epitope peptide combined vaccine to control PRRSV and Mhp infections. 相似文献
PurposeTo evaluate the midterm outcomes of percutaneous transluminal renal angioplasty (PTRA) for pediatric renovascular hypertension (RVH).Materials and MethodsThe clinical data of patients who underwent PTRA for RVH in the authors’ hospital from 2012 to 2019 were retrospectively analyzed. Postprocedural blood pressure, glomerular filtration rate (GFR) of the affected kidney, restenosis, and complications were closely monitored.ResultsPTRA was performed in a total of 30 children (20 boys and 10 girls), with a mean age of 7.3 years ± 0.7 (range, 40 days to 13.9 years) and a mean weight of 25.0 kg ± 2.3 (range, 3.4–53 kg). The median follow-up period was 26.5 months (range, 1 month to 7.5 years). Technical success was achieved in 26 (86.7%) of the 30 patients. Restenosis developed in 3 patients (10.0%). Only 1 patient underwent stent implantation, and the stent fractured 8 months later, requiring further intervention. There were no other complications. In terms of clinical benefit of blood pressure control after the initial PTRA procedure, 15 patients (50%) were cured and 7 patients (23.3%) showed improvement. There was no significant difference in the etiology, lesion location, and lesion length between patients with clinical benefit and failure (P = .06, P = .202, and P = .06, respectively). GFR of the affected kidney was significantly improved from 19.9 mL/min ± 11.2 to 38.1 mL/min ± 11.9 at the 6-month follow-up after PTRA (P < .001).ConclusionsThe overall results of PTRA for pediatric RVH caused by different etiologies are promising. PTRA not only provided a clinical benefit of blood pressure control in 73.3% of the patients but also significantly improved the function of the affected kidney. 相似文献
Introduction: The Hedgehog (HH) pathway constitutes a collection of signaling molecules which critically influence embryogenesis. In adults, however, the HH pathway remains integral to the proliferation, maintenance, and apoptosis of adult stem cells including hematopoietic stem cells.
Areas covered: We discuss the current understanding of the HH pathway as it relates to normal hematopoiesis, the pathology of acute myeloid leukemia (AML), the rationale for and data from combination therapies including HH pathway inhibitors, and ultimately the prospects that might offer promise in targeting this pathway in AML.
Expert opinion: Efforts to target the HH pathway have been focused on impeding this disposition and restoring chemosensitivity to conventional myeloid neoplasm therapies. The year 2018 saw the first approval of a HH pathway inhibitor (glasdegib) for AML, though for an older population and in combination with an uncommonly-used therapy. Several other clinical trials with agents targeting modulators of HH signaling in AML and MDS are underway. Further study and understanding of the interplay between the numerous aspects of HH signaling and how it relates to the augmented survival of AML will provide a more reliable substrate for therapeutic strategies in patients with this poor-risk disease. 相似文献
Background: Aniridia is a rare developmental eye disorder characterized by complete or partial iris hypoplasia often accompanied with other ocular changes that affect the cornea, anterior chamber, lens, retina, and optic nerve. Most cases of aniridia are inherited with an autosomal dominant mode of inheritance caused by PAX6 mutations or deletions. To reveal the underlying genetic defect in a four-generation Iranian family with aniridia, we carried out a genetic screening of PAX6.
Methods: Complete ophthalmic examinations were performed for available affected family members. All PAX6 exons and their flanking regions were sequenced for affected individuals. Candidate variation was screened for segregation in the pedigree by Sanger sequencing. Bioinformatics prediction was done to evaluate the deleterious effects of the mutation on protein product. Real-time PCR was used to investigate the impact of the variant on PAX6 mRNA expression.
Results: All patients were diagnosed with isolated aniridia associated with variable phenotypic features including retinal detachment. A novel heterozygous deletion c.320_348delTGTCCGAGGGGGTCTGTACCAACGATAAC (p.Leu107HisfsX16) on PAX6 gene was detected. Decreased mRNA level of PAX6 in the affected individuals indicated that the mutation caused nonsense-mediated mRNA decay (NMD).
Conclusions: To the best of our knowledge, it is the first report on the genetics of aniridia in Iran. Segregation analysis, bioinformatics prediction and confirmation of NMD, all support the proposition that the novel observed PAX6 mutation is the cause of aniridia in the pedigree. Retinal detachment in some of the affected members, which is a rare reported phenotypic feature of aniridia patients, may be associated with this mutation. 相似文献