A 25-year-old, emaciated man without medical treatment was found to have died suddenly at home by his mother. At autopsy, there were no injuries to his body, but significant circulatory insufficiency was observed. Electron microscopy revealed abnormal mitochondria in cells of the cardiac conduction system. The conduction system was filled with mitochondrial size abnormalities and mitochondrial cristae abnormalities. No notable abnormal findings were observed in other organs. Genetic examination of the blood revealed the mitochondrial pathogenetic variant m.3243A>G. Epileptic seizures, diabetic ketoacidosis, and hyperosmolar hyperglycemic state were unlikely to be the cause of sudden death. The cause of death was diagnosed as arrhythmia possibly induced by the failure of the cardiac conduction system due to mitochondrial disease. This is a rare case of sudden death caused by an accumulation of abnormal mitochondria in the cardiac conduction system. 相似文献
Congenital aniridia is a panocular disorder that is typically characterized by iris hypoplasia and aniridia-associated keratopathy (AAK). AAK results in the progressive loss of corneal transparency and thereby loss of vision. Currently, there is no approved therapy to delay or prevent its progression, and clinical management is challenging because of phenotypic variability and high risk of complications after interventions; however, new insights into the molecular pathogenesis of AAK may help improve its management. Here, we review the current understanding about the pathogenesis and management of AAK. We highlight the biological mechanisms involved in AAK development with the aim to develop future treatment options, including surgical, pharmacological, cell therapies, and gene therapies. 相似文献
Introduction: Immune checkpoint inhibitors (ICI) are now a standard of care in the treatment of many cancers leading to durable responses in patients with metastatic disease. These agents are generally well tolerated but may lead to the occurrence of immune-related adverse events (irAEs). As any organ may be affected, clinicians should be aware of the broad range of clinical manifestations and symptoms and keep in mind that toxicities may occur late, at any point along a patient’s treatment course. Although the most common irAEs are rarely severe, some of them may be associated with great morbidity and even become life-threatening. The rate of occurrence, type and severity of irAEs may vary with the type of ICI; thus, grade 3 and 4 irAEs are reported in more than 55% of patients treated with the combination of ipilimumab 3 mg/kg and nivolumab 1 mg/kg.
Area covered: This review presents the management of irAEs resulting from checkpoint blockade, with a focus on rare irAEs.
Expert commentary: With the development of immuno-oncology and the expanding role of ICI, physicians have learnt to diagnose and treat most of the irAEs that can occur. This review provides an overview of current guidelines, previously published studies and our multidisciplinary team based practices. 相似文献
Gold nanoparticles (Au NPs) hold great promise in food, industrial and biomedical applications due to their unique physicochemical properties. However, influences of the gastrointestinal tract (GIT), a likely route for Au NPs administration, on the physicochemical properties of Au NPs has been rarely evaluated. Here, we investigated the influence of GIT fluids on the physicochemical properties of Au NPs (5, 50, and 100?nm) and their implications on intestinal epithelial permeability in vitro. Au NPs aggregated in fasted gastric fluids and generated hydroxyl radicals in the presence of H2O2. Cell studies showed that GIT fluids incubation of Au NPs affected the cellular uptake of Au NPs but did not induce cytotoxicity or disturb the intestinal epithelial permeability. 相似文献
Background: Aniridia is a rare developmental eye disorder characterized by complete or partial iris hypoplasia often accompanied with other ocular changes that affect the cornea, anterior chamber, lens, retina, and optic nerve. Most cases of aniridia are inherited with an autosomal dominant mode of inheritance caused by PAX6 mutations or deletions. To reveal the underlying genetic defect in a four-generation Iranian family with aniridia, we carried out a genetic screening of PAX6.
Methods: Complete ophthalmic examinations were performed for available affected family members. All PAX6 exons and their flanking regions were sequenced for affected individuals. Candidate variation was screened for segregation in the pedigree by Sanger sequencing. Bioinformatics prediction was done to evaluate the deleterious effects of the mutation on protein product. Real-time PCR was used to investigate the impact of the variant on PAX6 mRNA expression.
Results: All patients were diagnosed with isolated aniridia associated with variable phenotypic features including retinal detachment. A novel heterozygous deletion c.320_348delTGTCCGAGGGGGTCTGTACCAACGATAAC (p.Leu107HisfsX16) on PAX6 gene was detected. Decreased mRNA level of PAX6 in the affected individuals indicated that the mutation caused nonsense-mediated mRNA decay (NMD).
Conclusions: To the best of our knowledge, it is the first report on the genetics of aniridia in Iran. Segregation analysis, bioinformatics prediction and confirmation of NMD, all support the proposition that the novel observed PAX6 mutation is the cause of aniridia in the pedigree. Retinal detachment in some of the affected members, which is a rare reported phenotypic feature of aniridia patients, may be associated with this mutation. 相似文献