Benign osteoblastoma of the occipital bone: Case report and literature review

We present a case of benign osteoblastoma of the occipital bone. Benign osteoblastoma is an uncommon primary bone tumor, which usually involves the vertebrae and the long bones. This tumor rarely develops in the calvaria, showing a preference for the temporal and frontal bones when it does. To the best of our knowledge, this case is only the eighth reported case of benign osteoblastoma confined to the occipital bone. A 20‐year‐old male presented with a mild tender mass lesion of the occipital area, just below the lambda. Plain X‐ray films and CT scans demonstrated an osteolytic mass surrounded by the sclerotic rim within the diploic space. MRI proved to be effective for the evaluation of the intracranial and intraosseous extensions of the tumor. However, it was very difficult to formulate a differential diagnosis against other osteoblastic tumors, or osteoid osteoma, in view of its radiological appearance. The final diagnosis was obtained by careful consideration of the histopathological characteristics of the tumor combined with its clinical and radiological features. Although generally regarded as benign, a complete resection is preferred over conventional curettage as this can guard against possible recurrence and malignant transformation.     

EXAMINATION OF DEVELOPMENTAL NEUROTOXICITY BY THE USE OF TISSUE CULTURE MODEL SYSTEMS

1. The rotation-mediated three-dimensional reaggregate culture system is uniquely suited for studies on developmental neurotoxicity. In this system, it is possible to reconstruct central neuronal pathways and follow their development. 2. Exposure to drugs of abuse including methamphetamine and methylenedioxyamphetamine or the appetite suppressant, fenfluramine, reduces monoamines in the cultures in a dose-dependent manner and interrupts normal monoaminergic development. 3. While the monoaminergic neurones may attain normal rates of development following drug removal, the affected neurones are not capable of overcoming the drug-induced insults and a deficiency in monoamines persists throughout development. 4. In addition, the production of immortalized monoclonal hybrid cells obtained by fusion of fetal mesencephalic neurones with a neuroblastoma has yielded cell lines expressing a dopaminergic phenotype. 5. Such cells have been useful in establishing the relationship of neurotoxicity to cell lineage and can serve as models for the study of the cellular and molecular mechanisms of neurotoxicity.     

The effect of combinations of ampligen and zidovudine or dideoxyinosine against human immunodeficiency viruses in vitro.

The combinations of ampligen and zidovudine at ratios of 100:1, 25:1, 10:1, and 1:50 acted synergistically to reduce cytopathology caused by HIV in MT-2 cell cultures. Combination indices were less than 1 at all of these ratios representing different combinations of concentrations and at 3 effective doses (ED30, ED50, ED70). Combination of drugs which show synergism at a wide range of ratios of combinations suggest that they may be useful clinically, and that the antiviral efficacy of ZDV may be increased in combination with ampligen. Synergism was also found between ampligen and zidovudine by reduction of HIV-produced plaques in a HeLa cell line expressing CD-4 receptors. However the combination of ampligen and dideoxyinosine against HIV in MT-2 cells was only additive and not synergistic.     

Polymorphisms in manganese superoxide dismutase and catalase genes: functional study in Hong Kong Chinese asthma patients

BACKGROUND: Reactive oxygen species may contribute to the pathogenesis of asthma. Functional genetic polymorphisms of antioxidant enzymes, superoxide dismutase (SOD) and catalase are good candidates for asthma susceptibility. OBJECTIVE: To investigate the association of the manganese-containing form of SOD (MnSOD) gene at amino acid position 16 (Val16Ala) and catalase gene in the promoter at A-21T and C-262T polymorphisms and asthma in a Hong Kong Chinese population. METHODS: The association study was conducted in a case-control design in asthma patients (n=251) and healthy controls (n=316) by genotyping. The functional significance was assessed by determining erythrocyte SOD and catalase activity. RESULTS: The Val allele of MnSOD at Val16Ala and the A allele of catalase gene at A-21T were not different between patients and controls, while the C allele of catalase gene at C-262T was found to be significantly different between patients and controls (P=0.033). The less frequent variant of catalase gene (-262T) was found to be protective from the development of asthma in a Hong Kong Chinese non-smoking population (adjusted odds ratio=0.35, 0.15-0.85; P=0.017). Asthma patients had elevated erythrocyte SOD and catalase activities in comparison with healthy controls (P<0.01). However, their activities were not associated with different genotypes within healthy controls or asthma patients. CONCLUSION: This is the first report showing that SOD and catalase functional activities are not associated with their respective genetic polymorphisms but related to the presence of asthma in a Hong Kong Chinese population.     

Nucleotide changes around the splicing acceptor of intron 24 in the factor VIII gene and its impact on splicing.

Nucleotide 6724 of the factor VIII gene harbors a polymorphism of low frequency. A report from Taiwan claimed that 97.9% of the 83 alleles examined were of the A nucleotide at this position, which is quite different to the data from Western populations. Furthermore, this nucleotide is the start of exon 25, located in juxtaposition to the splicing acceptor of intron 24. We wonder if the nucleotide change at this location might have any effect on the splicing process of pre-mRNA. Using genomic DNA with direct sequencing of the polymerase chain reaction-amplified intron 24/exon 25 junction site, we found that 59 of the 60 patient samples were of the GTG sequence at nucleotides 6724-6726. The polymorphism is similar between populations in Taiwan and Western countries. The sequence of intron 24 around the splicing acceptor was always TCCAACTCTATTGCCCTCAG (-20 to -1), except for one hemophiliac patient who had a mutation in which the absolute consensus AG doublet of the intron 24 splicing acceptor changed to the AA dinucleotide. Owing to the mutation, exon 24 was erroneously spliced to exon 26, and exon 25 was skipped. This finding further testifies to the importance of the invariant AG dinucleotide in the example of the factor VIII gene.     

Tests for latent tuberculosis

Sir, In their article, Shankar and colleagues underline the significantburden of tuberculosis within their population and the importanceof identifying latent infection     

Identification of a parathyroid hormone in the fish Fugu rubripes.

A PTH gene has been isolated from the fish Fugu rubripes. The encoded protein of 80 amino acid has the lowest homology with any of the PTH family members. Fugu PTH(1-34) had 5-fold lower potency than human PTH(1-34) in a mammalian cell system. INTRODUCTION: Parathyroid hormone (PTH) is the major hypercalcemic hormone in higher vertebrates. Fish lack parathyroid glands, but there have numerous attempts to identify and isolate PTH from fish. MATERIALS AND METHODS: Polymerase chain reaction (PCR) was performed with primers based on preliminary data from the Joint Genome Institute database. PCR amplification was performed on genomic DNA isolated from Fugu rubripes. PCR products were purified and DNA was sequenced. All sequence was confirmed from more than one independently amplified PCR product. Multiple sequence alignments were carried out, and the percentage of identities and similarities were calculated. An unrooted phylogenetic tree, using all the known PTH and PTH-related protein (PTHrP) amino acid sequences, was determined. Synthetic peptides were tested in a biological assay that measured cyclic adenosine 3',5'-monophosphate formation in UMR106.1 cells. Rabbit polyclonal antisera specific for N-terminal human PTHrP and one rabbit polyclonal antiserum specific for N terminus hPTH were used to test the cross-reactivity with fPTH(1-34) in immunoblots.