Evaluation of BAX and BCL-2 Gene Expression and Apoptosis Induction in Acute Lymphoblastic Leukemia Cell Line CCRFCEM after High- Dose Prednisolone Treatment

Objective: Glucocorticoids are one of the most important drugs in the treatment of acute lymphoblastic leukemiafor children. It is very important to response to glucocorticoid in the prognosis of these patients. Therefore, resistanceto treatment is a major problem in lymphoid leukemia cases. In, this study, CCRF-CEM cell line was selected as achemotherapy-resistant model. The aim of this study was to evaluate the effect of high dose prednisolone on inductionof apoptosis and changes in BAX and BCL-2 gene expression at different times. Methods: CCRF-CEM cell lines weregrown in standard conditions. Based on previous studies, a dose of 700 μM as subtoxic dose was selected. Changes ingene expression of BAX and BCL-2 were evaluated by using real time PCR techniques. Also stained with annexin Vand the induction of apoptosis was assessed by FACS machine. Results: In this study it was found that prednisolone inhigh doses at different times significantly increased the gene expression of BAX and on the other hand the amount ofBCL-2 expression was reduced. Cells that treated for 48 hours had more significant changes in gene expression. Basedon flowcytometry data, prednisolone can induce apoptosis in a time dependent manner on this cancerous resistant cellline. Conclusions: Apoptosis induced by high-dose prednisolone in the CCRF-CEM cells, which is almost resistant,and possibly mediated by reducing the expression of BCL-2 and BAX up-regulation.     

Effects of dexmedetomidine on isoflurane requirements in healthy volunteers. 1: Pharmacodynamic and pharmacokinetic interactions

Dexmedetomidine is a highly selective alpha 2-adrenoceptor agonist with anaesthetic-sparing effects. We have determined the pharmacodynamic and pharmacokinetic interactions between dexmedetomidine and isoflurane in volunteers. Nine male subjects were allocated randomly to receive isoflurane anaesthesia preceded by infusion of dexmedetomidine on three separate occasions, 2 weeks apart. Dexmedetomidine target plasma concentrations were 0.0 (placebo), 0.3 ng ml-1 (low-dex) and 0.6 ng ml- 1 (high-dex). End-tidal isoflurane concentrations at which gross purposeful movement and response to verbal commands occurred were identified. In the recovery period, sedation scores and digit symbol substitution tests were recorded. Venous blood samples were obtained before, during and after anaesthesia at predetermined intervals for measurement of plasma concentrations of dexmedetomidine and calculation of standard pharmacokinetic indices (AUC, Cl, Vss, T1/2 alpha, T1/2 beta). The end-tidal isoflurane concentration at which 50% of subjects first responded to the tetanic stimulus was 1.05% in the placebo group, 0.72% in the low-dex group and 0.52% in the high-dex group. We conclude that dexmedetomidine decreased isoflurane requirements in a dose- dependent manner and reduced heart rate, systolic and diastolic arterial pressures. Sedation and slight impairment of cognitive function persisted for several hours after anaesthesia and the end of infusion of dexmedetomidine. Isoflurane did not appear to influence the pharmacokinetics of dexmedetomidine.      

Screening of Stool Samples for Identification of Vancomycin-Resistant Enterococcus Isolates Should Include the Methyl-α-dGlucopyranoside Test To Differentiate Nonmotile Enterococcus gallinarum from E. faecium

The methyl-α-d-glucopyranoside (MDG) test has been shown to be superior to motility testing in differentiating Enterococcus faecium from E. gallinarum. In the present study, 33 vancomycin-resistant enterococcus (VRE) isolates collected as part of a stool surveillance study were compared by using motility and MDG. Motility testing identified all 33 isolates as E. faecium, whereas MDG identified 11 of the 33 isolates as nonmotile E. gallinarum. The MDG results were confirmed by sequencing the 16S rDNA V6-to-V8 region. We conclude that the MDG test is a necessary component of routine VRE screening.Enterococci have been shown to be the second most common cause of nosocomial infection in the United States (15). Enterococcus faecalis is responsible for the majority of enterococcal infections, whereas E. faecium, while responsible for significantly fewer infections, is more commonly associated with resistance to beta-lactams, fluoroquinones, and glycopeptides (9, 10) and is associated with greater morbidity and mortality (7). As the prevalence of infections caused by vancomycin-resistant enterococci (VRE) is presently low, the screening of stool for identification of colonizers in high-risk patients is the focus of several epidemiological studies (10, 13). It is critical in such screening studies to differentiate E. faecalis and E. faecium from other enterococcal species, such as E. gallinarum and E. casseliflavus, which do not normally cause human disease but commonly demonstrate intrinsic low-level glycopeptide resistance (1). Recent reports suggest that motility alone as the criterion for differentiating between E. gallinarum and E. faecium (3) is inadequate and may lead to the misidentification of isolates of nonmotile E. gallinarum as E. faecium (5).Recently, Devriese and coworkers have shown the methyl-α-d-glycopyranoside (MDG) test to be reliable and accurate in differentiating E. casseliflavus and E. gallinarum from E. faecalis and E. faecium (4). We were interested in determining the impact of the MDG test using a collection of vancomycin-resistant E. faecium isolates taken from a recent stool surveillance project (10) in which 1,500 enterococcal isolates had been identified to species level with a conventional identification algorithm, not containing MDG (8). The susceptibilities to glycopeptides vancomycin and teicoplanin and the glycopeptide resistance genotypes were also determined (6, 11).Frozen stock cultures of 33 vancomycin-resistant E. faecium isolates (MIC, 4 μg/ml) obtained in the VRE prevalence study were subcultured onto Trypticase soy–5% sheep blood agar and incubated at 37°C for 24 h for MDG testing and PCR lysate preparation. MDG testing of all VRE isolates was performed as previously described by Devriese et al. (4). Enterococcal species identification of each isolate was confirmed by sequencing the V6-to-V8 region (12) of the 16S rDNA which corresponds to bp 929 to 1369 of the Escherichia coli 16S rRNA sequence (2). The following ATCC strains were chosen for sequence determination: E. faecalis ATCC 29212, E. faecium ATCC 35667, E. gallinarum ATCC 35038, and E. casseliflavus ATCC 12755. Thirty-two enterococcal isolates from the stool surveillance project had also been sequenced to confirm the specificity and consistency of all sequences: 9 E. faecium isolates, 10 E. faecalis isolates, 5 E. casseliflavus isolates, and 8 E. gallinarum isolates. Subsequently, sequencing of the V6-V8 region of the 16S rDNAs of all 33 VRE isolates tested for MDG was performed. DNA extracts were prepared by using one or two colonies from the 24-h subcultures. DNA was isolated by using the QIAamp tissue kit (Qiagen, Santa Clarita, Calif.) in accordance with the manufacturer’s protocol. PCR amplification was performed by using universal 16S rDNA gene primers 91E(G) (5′TCAAAGGAATTGACGGGGGC) and 13B (5′AGGCCCGGGAACGTATTCAC) (14). A 50-μl PCR mixture contained 5 μl of DNA template; 5 μl of 25 mM MgCl₂–10× PCR buffer; 1.25 mM each dCTP, dGTP, dATP, and dUTP · dTTP in an 8:1 ratio; 0.5 μl of 100 mM each primer; 0.5 U of uracil DNA glycosylase (GibcoBRL, Burlington, Canada); 2.5 U of Taq DNA polymerase (Pharmacia Biotech, Baie d’Urfé, Canada); and 30 μl of sterile distilled H₂O. The PCR was performed with a Perkin-Elmer GeneAmp PCR System 9600 with cycles of 37°C for 10 min and 95°C for 10 min and 30 cycles of 95, 55, and 72°C for 1 min each and incubated at 72°C for 10 min for final extension.Sequencing reactions were performed with the ABI PRISM Dye Terminator Cycle Sequencing Ready Reaction kit (PE Applied Biosystems, Foster City, Calif.). The primer used for the sequencing reaction was 91E(G) or 13B diluted 1:100 in Tris-EDTA buffer. Cycle sequencing on the GeneAmp PCR System 9600 was performed, and sequencing analysis was performed with the PE-ABI 373 DNA sequencing system and Software 373 in accordance with the manufacturers’ instructions.The results obtained by MDG testing for all 33 VRE isolates demonstrated that 22 isolates were MDG negative, showing concordance with prior motility-based E. faecium identification. However, 11 VRE isolates tested MDG positive, indicating that they were in fact not E. faecium as originally reported but, instead, nonmotile E. gallinarum (Table ​(Table1).1). These 11 strains all possessed low-level glycopeptide resistance, with vancomycin and teicoplanin MICs of 4 to 8 μg/ml and 0.25 to 0.5 μg/ml, respectively.

TABLE 1

Comparison of MDG testing and species identification using sequencing with conventional testing of 33 VRE (E. faecium) isolates

Diagnosis and management of orbital inflammation and infections secondary to foreign bodies: a clinical review

Orbital inflammation and secondary infections may be caused by many types of foreign bodies, including organic and inorganic matter, non-autogenous surgical implants and allografts, and surgical hardware and materials utilized in reconstructive surgery. In penetrating injury patients, the nature of the foreign body determines the clinical behavior; inert objects such as steel and glass may not cause significant inflammation to warrant their removal. Removal of organic foreign bodies, however, is mandatory since these objects usually lead to secondary infection with abscess and fistula formation. This paper reviews salient points related to history-taking and physical examination, diagnostic workup, and medical and surgical treatment in foreign body-induced orbital inflammation and infections. It is emphasized that practically every case of orbital trauma should be approached with a high index of suspicion for penetrating injury with possible intraorbital foreign body. The investigational tools to detect orbital foreign bodies, including ultrasonography, computed tomography and magnetic resonance imaging, are reviewed. The principles of the management, including antimicrobial therapy, surgical indications and techniques, are also discussed.     

Effect of artificial mixtures of environmental polycyclic aromatic hydrocarbons present in coal tar, urban dust, and diesel exhaust particulates on MCF-7 cells in culture

Human exposure to polycyclic aromatic hydrocarbons (PAHs) occurs through complex mixtures. The National Institute of Standards and Technology has established standard reference materials (SRMs) for selected PAH mixtures that are composed of carcinogenic, noncarcinogenic, and weakly carcinogenic compounds, such as those derived from coal tar (SRM 1597), atmospheric particulate matter (SRM 1649), and diesel particulate matter (SRM 1650). To study the effects of PAHs with different carcinogenic potential in complex mixtures, and to investigate the metabolic activation of noncarcinogenic and weakly carcinogenic PAHs to DNA-binding derivatives, artificial mixtures (1597H, 1649H, and 1650H) were prepared in the laboratory. These artificial mixtures contained the same relative ratios of noncarcinogenic and weakly carcinogenic PAHs present in SRM 1597, SRM 1649, and SRM 1650. The human mammary carcinoma-derived cell line MCF-7 was treated with these artificial mixtures and analyzed for PAH-DNA adduct formation and the induction of cytochrome P450 (CYP) enzymes. We found that the artificial mixtures formed lower but detectable levels of DNA adducts 24 and 48 hr after treatment than benzo[a]pyrene. Induction of CYP enzyme activity was measured by the ethoxyresorufin-O-deethylase assay, and the expression of CYP1A1 and CYP1B1 was confirmed by immunoblots. Both noncarcinogenic and weakly carcinogenic PAHs present in the artificial mixtures have the ability to induce CYP1A1 and CYP1B1 in MCF-7 cells and contribute to DNA binding. Therefore, it is necessary to take into account the noncarcinogenic and weakly carcinogenic PAHs present in environmental mixtures in assessing the potential risk associated with human exposure.     

Median and musculocutaneous nerves: variant formation and distribution

An unusual formation of the median and musculocutaneous nerves was observed during routine dissection of the left upper limb of a 60-year-old Caucasian male cadaver. The median nerve was formed by the fusion of three roots, two from the lateral and one from the medial cord of the brachial plexus. The variant lateral root of the median nerve followed an anomalous course, crossing anterior to the distal part of the axillary artery. Moreover, in the distal half of the arm, the median nerve contributed a communicating branch to the musculocutaneous nerve. Injury to such a variant median nerve in the proximal arm may lead to paresthesia along the preaxial border of the forearm, weakness of elbow flexion, in addition to other manifestations of median nerve injury. The developmental and clinical significance of this anomaly is discussed.     

Perirhinal cortex and place-object conditional learning in the rat

The present study examined whether excitotoxic lesions of the perirhinal cortex can affect acquisition of a place-object conditional task in which object and spatial information must be integrated. Testing was carried out in a double Y-maze apparatus, in which rats learned a conditional rule of the type, "In Place X, choose Object A, not Object B (A+ vs. B-); in Place Y, choose Object B, not Object A (A- vs. B+)." Perirhinal cortex lesions significantly impaired acquisition of this task while sparing performance of an allocentric spatial memory task performed in a radial arm maze. Perirhinal cortex lesions also had no apparent effect on a 1-pair object discrimination task performed in the double Y maze or on retention and acquisition of 4-pair concurrent discrimination problems performed in a computer-automated touch screen testing apparatus. The results suggest that, although the perirhinal cortex and hippocampus can be functionally dissociated, their normal mode of operation includes the integration of object and spatial information.     

Nasopharyngeal carcinomas frequently lack the p16/MTS1 tumor suppressor protein but consistently express the retinoblastoma gene product.

The p16/MTS1 gene is altered by deletion, mutation, or hypermethylation in a wide variety of human cancers. As a result of deficient p16 protein, these cancers lack a critical mechanism for halting G1/S cell cycle progression. In the current study, 59 cases of nasopharyngeal carcinoma were evaluated for expression of the p16 tumor suppressor protein by immunohistochemical analysis of paraffin-embedded tissue. There was no detectable p16 in 38/59 cases (64%), which implies a very high rate of p16 inactivation in this type of cancer. On the other hand, the retinoblastoma gene product, which also regulates the G1 to S phase transition of the cell cycle, was consistently expressed in nasopharyngeal carcinomas by immunohistochemical analysis. These results implicate p16 inactivation but not Rb alteration in the stepwise progression of nasopharyngeal carcinogenesis.     

Controlling intraoperative hemorrhage during burn surgery: A prospective,randomized trial comparing NuStat® hemostatic dressing to the historic standard of care

Introduction

One of the primary intraoperative challenges during burn surgery is to adequately excise the burn while avoiding massive hemorrhage. This has become increasingly important, as we see more burn patients that are older and with more medical comorbidities. While adequate excision down to healthy tissues for deep burns is essential for skin graft to take, it also leads to active bleeding that can be a challenge to control. Good hemostasis is imperative as a hematoma is the most common cause of graft loss. Several new products have become available to help control intraoperative hemorrhage. A new hemostatic dressing, NuStat^®, is available and approved by FDA in United States.