Vildagliptin Recruits Regulatory T Cells in Patients Undergoing Primary Percutaneous Coronary Intervention

Regulatory T cells (Treg) has been documented to be protective against myocardial ischemia–reperfusion injury (MIRI). The administration of drugs which recruit Treg cells may participate in the cardioprotection of MIRI. The purpose of the present study was to investigate whether the add-on vildagliptin (vild) to standard treatment of MIRI prior to reperfusion could increase Treg recruitment, anti-inflammatory, and antioxidant effects of the standard treatment or not. Sixty diabetic patients with ST-segment elevation myocardial infarction were randomly divided into two equal groups: control group was given the standard medical treatment and vild group was given the standard medical treatment plus vild. There were no statistical differences between the mean of percentage of changes in nitric oxide, ischemia modified albumin, highly sensitive C reactive protein, and interferon-gamma levels in the studied groups. While, the percentages of changes of myeloperoxidase level, CD4+CD25+ Treg cells count, and transforming growth factor-beta1 level were significantly higher in vild group compared with control group. We concluded that addition of vild to standard medical treatment of MIRI could increase its effectiveness through recruitment of CD4+CD25+ Treg cells.     

Predictors of impaired renal function among HIV infected patients commencing highly active antiretroviral therapy in Jos, Nigeria

Background:

Kidney disease is a common complication of human immunodeficiency virus (HIV) infection even in the era of antiretroviral therapy, with kidney function being abnormal in up to 30% of HIV-infected patients. We determined the predictors of impaired renal function in HIV-infected adults initiating highly active antiretroviral therapy (HAART) in Nigeria.

Materials and Methods:

This was a retrospective study among HIV-1 infected patients attending the antiretroviral clinic at the Jos University Teaching Hospital (JUTH), between November 2005 and November 2007. Data were analysed for age, gender, weight, WHO clinical stage, CD4 count, HIV-1 RNA viral load, HBsAg and anti-HCV antibody status. Estimated glomerular filtration rate (eGFR) was calculated using the Cockcroft-Gault equation. Statistical analysis was done using Epi Info 3.5.1.

Results:

Data for 491 (294 females and 197 males) eligible patients were abstracted. The mean age of this population was 38.8±8.87 years. One hundred and seventeen patients (23.8%; 95% CI, 20.2-27.9%) had a reduced eGFR (defined as <60 mL/min), with more females than males (28.6% vs. 16.8%; P=0.02) having reduced eGFR. Age and female sex were found to have significant associations with reduced eGFR. Adjusted odds ratios were 1.07 (95% CI, 1.04, 1.10) and 1.96 (95% CI, 1.23, 3.12) for age and female sex, respectively.

Conclusions:

Older age and female sex are independently associated with a higher likelihood of having lower eGFRs at initiation of HAART among our study population. We recommend assessment of renal function of HIV-infected patients prior to initiation of HAART to guide the choice and dosing of antiretroviral drugs.     

Arterial and end-tidal carbon dioxide difference in pediatric intensive care

Background and Aim:

Arterial carbon dioxide tension (PaCO₂) is considered the gold standard for scrupulous monitoring in pediatric intensive care unit (PICU), but it is invasive, laborious, expensive, and intermittent. The study aims to explore when we can use end-tidal carbon dioxide tension (P_ETCO₂) as a reliable, continuous, and noninvasive monitor of arterial CO₂

Materials and Methods:

Concurrent P_ETCO₂, fraction of inspired oxygen, PaCO₂, and arterial oxygen tension values of clinically stable children on mechanical ventilation were recorded. Children with extra-pulmonary ventriculoatrial shunts were excluded. The P_ETCO₂ and PaCO₂ difference and its variability and reproducibility were studied.

Results:

A total of 624 concurrent readings were obtained from 105 children (mean age [SD] 5.53 [5.43] years) requiring invasive bi-level positive airway pressure ventilation in the PICU. All had continuous P_ETCO₂ monitoring and an arterial line for blood gas measurement. The mean (SD) number of concurrent readings obtained from each child, 4-6 h apart was 6.0 (4.05). The P_ETCO₂ values were higher than PaCO₂ in 142 observations (22.7%). The PaCO₂–P_ETCO₂ difference was individual admission specific (ANOVA, P < 0.001). The PaCO₂–P_ETCO₂ difference correlated positively with the alveolar-arterial oxygen tension [P(A-a)O₂] difference (ρ = 0.381 P < 0.0001). There was a fixed bias between the P_ETCO₂ and PaCO₂ measuring methods, difference +0.66 KPa (95% confidence interval: +0.57 to +0.76).

Conclusions:

The PaCO₂–P_ETCO₂ difference was individual specific. It was not affected by the primary disorder leading to the ventilation.     

A novel PAX6 mutation causes congenital aniridia with or without retinal detachment

Background: Aniridia is a rare developmental eye disorder characterized by complete or partial iris hypoplasia often accompanied with other ocular changes that affect the cornea, anterior chamber, lens, retina, and optic nerve. Most cases of aniridia are inherited with an autosomal dominant mode of inheritance caused by PAX6 mutations or deletions. To reveal the underlying genetic defect in a four-generation Iranian family with aniridia, we carried out a genetic screening of PAX6.

Methods: Complete ophthalmic examinations were performed for available affected family members. All PAX6 exons and their flanking regions were sequenced for affected individuals. Candidate variation was screened for segregation in the pedigree by Sanger sequencing. Bioinformatics prediction was done to evaluate the deleterious effects of the mutation on protein product. Real-time PCR was used to investigate the impact of the variant on PAX6 mRNA expression.

Results: All patients were diagnosed with isolated aniridia associated with variable phenotypic features including retinal detachment. A novel heterozygous deletion c.320_348delTGTCCGAGGGGGTCTGTACCAACGATAAC (p.Leu107HisfsX16) on PAX6 gene was detected. Decreased mRNA level of PAX6 in the affected individuals indicated that the mutation caused nonsense-mediated mRNA decay (NMD).

Conclusions: To the best of our knowledge, it is the first report on the genetics of aniridia in Iran. Segregation analysis, bioinformatics prediction and confirmation of NMD, all support the proposition that the novel observed PAX6 mutation is the cause of aniridia in the pedigree. Retinal detachment in some of the affected members, which is a rare reported phenotypic feature of aniridia patients, may be associated with this mutation.     

Cichorin A: a new benzo-isochromene from Cichorium intybus

One new benzo-isochromene, named cichorin A (1), together with three known compounds oleanolic acid, β-sitosterol, and β-sitosterol glucopyranoside, was isolated from Cichorium intybus. The structure of the new compound was elucidated by detailed spectroscopic analysis such as (1)H, (13)C NMR, COSY, HMQC, HMBC, and HR-EI-MS. Relative configuration of asymmetric centers of cichorin A (1) was determined by the analysis of the (1)H NMR coupling constants together with the NOESY experiment.     

Lipoxygenase inhibitory sphingolipids from Launaea nudicaulis

Four new sphingolipids: nudicaulin A [(2S,3S,4R,14E)-2-{[octadecanoyl]amino}tetraeicos-14-ene-1,3,4-triol; 1], nudicaulin B [(2S,3S,4R,14E)-2-{[(2R)-2-hydroxyoctadecanoyl]amino}tetraeicos-14-ene-1,3,4-triol; 2], nudicaulin C [(2S,3S,4R,14E)-2-{[(2R)-2-hydroxyoctadecanoyl]amino}tetraeicos-14-ene-1,3,4-triol-1-O-β-d-glucopyranoside; 3], and nudicaulin D [(2S,3S,4R)-2-{[(2R,3S,12E)-2,3-dihydroxyeicos-12-enoyl]amino}octadecane-1,3,4-triol; 4] together with 1-hexatriacontanol, β-sitosterol, octadecyl 4-hydroxycinnamate, elaidic acid, cholesta-5,22-diene-3,7-diol, oleanolic acid, apigenin, and β-sitosterol 3-O-β-d-glucopyranoside were isolated from the methanolic extract of the whole plant of Launaea nudicaulis. Their structures were elucidated using ¹H and ¹³C NMR spectra and 2D NMR analyses (HMQC, HMBC, and COSY) in combination with mass spectrometry (EI-MS, HR-EI-MS, FAB-MS, and HR-FAB-MS) experiments and comparison with literature data of related compounds. Compounds 1–4 displayed moderate inhibitory potential against enzyme lipoxygenase in concentration-dependent manner with IC₅₀ value ranges 103–193 μM.     

Community-Based Assessment of Knowledge,Attitude, Practices and Risk Factors Regarding COVID-19 Among Pakistanis Residents During a Recent Outbreak: A Cross-Sectional Survey

Exceptional precautionary measures have been adopted to stop the transmission and control of COVID-19 through the world and Pakistan is facing lockdown in this scenario. Public loyalty to precautionary measures is affected by their knowledge, attitude, risk factors and practices (KAP) towards COVID-19. The present study was conducted among the Pakistani residents to observe the knowledge, attitude, practices and risk factors towards COVID-19 outbreak in Pakistan. A questionnaire was designed, and a cross-sectional survey was conducted among participants of the study area. Participants were asked the questions regarding knowledge, attitude, practices and risk factors towards COVID-19. Data were analyzed by SPSS and t/F test and correlation was applied among the knowledge, attitude, risk factors and practices. A total of 1060 questionnaires were received. 1004 were included while 56 were excluded. The highest representation was from Punjab province (65.6%), female (63%) and age group of 21–30 years (62.1%). Most participants were single (85%), Muslim (99.4%), Urdu speaking (45.6%) and were graduates (51.5%). Most of the participants were students (52.9%) and were from economically middle-class families (40.8%). The knowledge was positively correlated with attitude and practices whereas negatively correlated with risk factors (P?<?0.05). The attitude was negatively correlated with risk factor and positively correlated with practices. The risk factors and practices were positively correlated with each other. Health education program to improve the COVID-19 knowledge, attitude, practices and risk factors should be initiated to combat current health challenge.

     

Evaluation of NMU-Induced Breast Cancer Treated with Sirolimus and Sunitinib on Breast Cancer Growth

Objective: To analyze the effect of sirolimus and sunitinib in blocking the tumor growth and to evaluate the expressions of estrogen receptor (ER), progesterone receptor (PgR), and human epidermal growth factor receptor-2 (HER2/neu) after treated with sirolimus and sunitinib. Methods: Thirty-two female Sprague Dawley rats at age 21-days old were administered intraperitoneally with N-Methyl-N-Nitroso Urea (NMU), dosed at 70mg/kg body weight. The rats were divided into 4 groups; Group 1 (Control, n=8), Group 2 (Sirolimus, n=8), Group 3 (Sunitinib, n=8) and Group 4 (Sirolimus+Sunitinib, n=8), being treated twice when the tumor reached the size of 14.5±0.5 mm and subsequently sacrificed after 5 days. The protein expressions of ER, PgR and HER2/neu of the tumor tissues were evaluated by using immunohistochemistry analysis. Results: Treatment with sirolimus alone lowered expressions of ER and PgR of breast cancer and reduced tumor size. There was no significant difference of ER and PgR expressions between control and sunitinib treated tumor. Sunitinib treated tumors reduce in diameter after the first treatment, however the diameter increases after the second treatment. Histologically, sunitinib treated tumor did not show any aggressive invasive carcinoma of no special type (NST) histological subtypes. In addition, all NMU-induced tumors are HER2/neu-negative scoring. Conclusion: Sirolimus is neither synergistic nor additive with sunitinib for breast cancer treatment.     

Reciprocal Interactions of Leukemic Cells with Bone Marrow Stromal Cells Promote Enrichment of Leukemic Stem Cell Compartments in Response to Curcumin and Daunorubicin

A predominant challenge in developing curative leukemia therapy is interactions of leukemic cells with the bone marrow stromal microenvironment. We aimed to investigate the role of stromal cells, such as bone marrow mesenchymal stromal cells (BMSCs) and osteoblasts (OBs), in curcumin (CUR) and daunorubicin (DNR) induced apoptosis of acute myeloid leukemia (AML) cells. We used KG1 and U937 as leukemia cell line models and treated them with CUR and DNR. The cells were then co-cultured with BMSCs or a combination of BMSCs and OBs as feeders. After 24 hours of co-culture, BMSCs or OBs were sorted and separated from the leukemia cells and apoptosis levels were analyzed by annexin/propidium iodide (PI) staining on flow cytometry. Potentially involved molecular pathways were analyzed at gene and protein levels by Real time PCR and western blotting, respectively. The results showed AML cells co-cultured with BMSCs plus OBs to be more resistant to drug induced-apoptosis compared to co-culture with BMSCs alone or without co-culture. Expression levels of OPN, CXCL-12, IL-6, STAT-3 and VCAM-1 were also significantly up-regulated in OBs and AML cells, at both mRNA and protein levels after co-culture, with concurrent enrichment of CD34+ AML cells. Our data showed, in a stromal cell niche-based model, that OBs revoke the influence of BMSCs on leukemic cells and promote enrichment of both CD34+ and CD34- leukemic stem cell (LSC) compartments in response to CUR and DNR. Up-regulation of OPN, CXCL-12, IL-6, STAT-3 and VCAM-1 in OBs and AML cells in co-culture might be part of molecular mechanisms that block CUR or CUR+DNR-induced apoptosis and promote enrichment of CD34+ and CD34- LSCs.