Reduction in acute rejections decreases chronic rejection graft failure in children: a report of the North American Pediatric Renal Transplant Cooperative Study (NAPRTCS).

Chronic rejection accounted for 32% of all graft losses in 7123 pediatric transplants. In a previous study acute, multiple acute and late acute rejections were risk factors for the development of chronic rejection. We postulated that the recent decrease in acute rejections would translate into a lower risk for chronic rejection among patients with recent transplants. We reviewed our data on patients transplanted from 1995 to 2000, and using multivariate analysis and a proportional hazards model developed risk factors for patients whose grafts had failed due to chronic rejection. A late initial rejection increased the risk of chronic rejection graft failure 3.6-fold (p < 0.001), while a second rejection resulted in further increase of 4.2-fold (p < 0.001). Recipients who received less than 5 mg/kg of cyclosporine at 30 days post-transplant had a relative risk (RR) of 1.9 (p = 0.02). Patients transplanted from 1995 to 2000 had a significantly lower risk (RR = 0.54, p < 0.001) of graft failure from chronic rejection than those who received their transplants earlier (1987-94). Since we were able to demonstrate that there is a decreased risk of chronic rejection graft failure in our study cohort, we would conclude that the goal of future transplants should be to minimize acute rejections.     

The impact of laparoscopic cholecystectomy on the treatment of symptomatic cholelithiasis

Background: There has been a debate about the cost-effectiveness of laparoscopic cholecystectomy (LC), as well as a concern regarding its possible overutilization and changes in the indication for surgery. Methods: A retrospective analysis of all cholecystectomies performed at UCDMC from 1988 to 1994 was done. The annual rate of cholecystectomy increased by 50% in 1990 when LC was introduced but has since stabilized at a rate 11% higher than the rate before LC. The disease status and severity did not change. Results: The incidence of nonelective surgery remained stable at 31.2% to 37.5%. Elective cholecystectomy had lower mortality (0.16% vs 1.8%, P=0.029), morbidity (2.6% vs 11.2%, P=0.0001), and conversion rate (2.6% vs 16%, P=0.0001) and a shorter length of stay (2.1 days vs 5.4 days), compared with nonelective procedure. Conclusions: The indication for surgery in cholelithiasis has not changed since the introduction of LC. In patients with symptomatic gallstones, early elective surgery is recommended and may be more cost-effective.Presented at the annual meeting of the Society of American Gastrointestinal Endoscopic Surgeons (SAGES), Orlando, FL, March 12–14, 1995     

Retrospective analysis of 5037 patients with nasopharyngeal carcinoma treated during 1976-1985: overall survival and patterns of failure.

This is a retrospective analysis of 5037 patients with squamous cell carcinoma of the nasopharynx treated during the years 1976-1985. The stage distribution according to Ho's classification was 9% Stage I, 13% II, 50% III, 22% IV, and 6% Stage V. Only 4488 (89%) patients had a full course of megavoltage radiation therapy. The median equivalent dose to the nasopharyngeal region was 65 Gy and cervical region in node-positive patients 53 Gy. Seventy percent (906/1290) of the node-negative patients had no prophylactic neck irradiation. The overall actuarial 10-year survival rate was 43%, and the corresponding failure-free survival 34%. Altogether, 4157 (83%) patients achieved complete remission lasting more than 6 months, but 53% (2205/4157) of them relapsed after a median interval of 1.4 years. The 10-year actuarial local, regional, and distant failure-free rates were 61%, 64%, and 59%, respectively. Thirty-eight percent (338/891) of all patients with local recurrence achieved second local remission. The local complete remission rate with aggressive re-irradiation alone was 47% (333/706). But 37% (124/338) of the responders recurred the second time. The incidence of distant failure correlated significantly with both the N-stage and the T-stage, with the highest (57%) occurring in patients with N3 disease. The incidence of nodal relapse in node-negative patients was 11% (44/384) among those given prophylactic neck irradiation, but 40% (362/906) among those without. Therapeutic irradiation achieved a complete regional remission rate of 90% (306/339). However, despite successful salvage, these patients had a significantly higher distant failure rate than those without nodal relapse, even if they remained local-failure-free (21% vs 6%). Patients treated during 1981-1985 achieved significantly better treatment results than those treated during 1976-1980, especially in terms of the overall survival (57% vs 47% at 5-year), the overall failure-free survival (42% vs 35% at 5-year), and the local failure-free rate (70% vs 63% at 5-year). The possible contributing factors are discussed.     

The effect of combinations of ampligen and zidovudine or dideoxyinosine against human immunodeficiency viruses in vitro.

The combinations of ampligen and zidovudine at ratios of 100:1, 25:1, 10:1, and 1:50 acted synergistically to reduce cytopathology caused by HIV in MT-2 cell cultures. Combination indices were less than 1 at all of these ratios representing different combinations of concentrations and at 3 effective doses (ED30, ED50, ED70). Combination of drugs which show synergism at a wide range of ratios of combinations suggest that they may be useful clinically, and that the antiviral efficacy of ZDV may be increased in combination with ampligen. Synergism was also found between ampligen and zidovudine by reduction of HIV-produced plaques in a HeLa cell line expressing CD-4 receptors. However the combination of ampligen and dideoxyinosine against HIV in MT-2 cells was only additive and not synergistic.     

Polymorphisms in manganese superoxide dismutase and catalase genes: functional study in Hong Kong Chinese asthma patients

BACKGROUND: Reactive oxygen species may contribute to the pathogenesis of asthma. Functional genetic polymorphisms of antioxidant enzymes, superoxide dismutase (SOD) and catalase are good candidates for asthma susceptibility. OBJECTIVE: To investigate the association of the manganese-containing form of SOD (MnSOD) gene at amino acid position 16 (Val16Ala) and catalase gene in the promoter at A-21T and C-262T polymorphisms and asthma in a Hong Kong Chinese population. METHODS: The association study was conducted in a case-control design in asthma patients (n=251) and healthy controls (n=316) by genotyping. The functional significance was assessed by determining erythrocyte SOD and catalase activity. RESULTS: The Val allele of MnSOD at Val16Ala and the A allele of catalase gene at A-21T were not different between patients and controls, while the C allele of catalase gene at C-262T was found to be significantly different between patients and controls (P=0.033). The less frequent variant of catalase gene (-262T) was found to be protective from the development of asthma in a Hong Kong Chinese non-smoking population (adjusted odds ratio=0.35, 0.15-0.85; P=0.017). Asthma patients had elevated erythrocyte SOD and catalase activities in comparison with healthy controls (P<0.01). However, their activities were not associated with different genotypes within healthy controls or asthma patients. CONCLUSION: This is the first report showing that SOD and catalase functional activities are not associated with their respective genetic polymorphisms but related to the presence of asthma in a Hong Kong Chinese population.     

The small ptotic breast: reposition autoaugmentation mammaplasty

Autoaugmentation mammaplasty of the small ptotic breast with adjacent pedicled fat and simultaneous correction of ptosis is presented. The operative procedure is described and some representative results are shown.     

Nucleotide changes around the splicing acceptor of intron 24 in the factor VIII gene and its impact on splicing.

Nucleotide 6724 of the factor VIII gene harbors a polymorphism of low frequency. A report from Taiwan claimed that 97.9% of the 83 alleles examined were of the A nucleotide at this position, which is quite different to the data from Western populations. Furthermore, this nucleotide is the start of exon 25, located in juxtaposition to the splicing acceptor of intron 24. We wonder if the nucleotide change at this location might have any effect on the splicing process of pre-mRNA. Using genomic DNA with direct sequencing of the polymerase chain reaction-amplified intron 24/exon 25 junction site, we found that 59 of the 60 patient samples were of the GTG sequence at nucleotides 6724-6726. The polymorphism is similar between populations in Taiwan and Western countries. The sequence of intron 24 around the splicing acceptor was always TCCAACTCTATTGCCCTCAG (-20 to -1), except for one hemophiliac patient who had a mutation in which the absolute consensus AG doublet of the intron 24 splicing acceptor changed to the AA dinucleotide. Owing to the mutation, exon 24 was erroneously spliced to exon 26, and exon 25 was skipped. This finding further testifies to the importance of the invariant AG dinucleotide in the example of the factor VIII gene.