Hypophosphatemic rickets with hypocalciuria following long-term treatment with aluminum-containing antacid

We present what we believe is the first case of rickets following prolonged treatment with aluminum containing antacids that bind phosphate, in an 18-year-old mentally retarded boy with cerebral palsy and spastic quadriplegia. As expected, serum calcitriol was increased and urinary phosphate excretion was very low. However, in contrast to all published cases of antacid induced hypophosphatemic osteomalacia in adults, despite a substantial increase in bone resorption reflected by urinary total hydroxyproline excretion, urinary calcium excretion was low rather than high, and significant hypocalcemia occurred after antacids were ceased and a phosphate salt administered. We suggest that the skeleton was so under-mineralized because of growth during prolonged phosphate deficiency, possibly augmented by anticonvulsant administration and immobilization, that increased bone resorption did not release enough calcium to cause hypercalciuria, or to prevent hypocalcemia during resumption of normal mineralization.     

The physical dependence liability of butorphanol: a comparative study with morphine.

In these studies, the physical dependence liability of butorphanol, a mixed 'agonist/antagonist' opioid analgesic, was compared to that of morphine. Male, Sprague-Dawley rats received i.c.v. infusions of saline (1 microliter/h), or an equimolar dose of butorphanol or morphine (52.3 nmol/h) for 3 days. The physical dependence liabilities of these two compounds were then compared by assessing both behavioral withdrawal signs and weight loss following naloxone-precipitated withdrawal. Body weight loss was also evaluated following abrupt (cessation of infusion) withdrawal from butorphanol or morphine. In animals receiving i.c.v. infusions of butorphanol or morphine, naloxone administration (5 mg/kg s.c.) induced an equivalent degree of body weight loss compared to saline-treated animals. In addition, the ED50 of naloxone to produce wet shakes, escape behavior, teeth chattering, urination and defecation was equivalent in rats receiving butorphanol or morphine. Infusions of butorphanol or morphine also produced an equivalent degree of weight loss in animals undergoing abrupt withdrawal. These results demonstrate then that a substantial degree of physical dependence had developed in rats which received a large dose of butorphanol.     

Effects of haloperidol on motor and cognitive functioning in aged mice

The effects of haloperidol on motor and functioning and cognitive functioning were studied in young (3-5 months old) and aged (20-22 months old) male mice by examining haloperidol-induced catalepsy and haloperidol-induced decrements in performance on a radial arm maze. The aged mice were much more sensitive to these adverse effects of haloperidol than were the young mice. Studies of the distribution of radioactivity from [3H]haloperidol to the brain indicated that the differences in sensitivity to this drug were not due to pharmacokinetic differences. The results demonstrate that mice are suitable for studies of aging-induced changes in the behavioral effects of neuroleptic agents.     

The effect of combinations of ampligen and zidovudine or dideoxyinosine against human immunodeficiency viruses in vitro.

The combinations of ampligen and zidovudine at ratios of 100:1, 25:1, 10:1, and 1:50 acted synergistically to reduce cytopathology caused by HIV in MT-2 cell cultures. Combination indices were less than 1 at all of these ratios representing different combinations of concentrations and at 3 effective doses (ED30, ED50, ED70). Combination of drugs which show synergism at a wide range of ratios of combinations suggest that they may be useful clinically, and that the antiviral efficacy of ZDV may be increased in combination with ampligen. Synergism was also found between ampligen and zidovudine by reduction of HIV-produced plaques in a HeLa cell line expressing CD-4 receptors. However the combination of ampligen and dideoxyinosine against HIV in MT-2 cells was only additive and not synergistic.     

Polymorphisms in manganese superoxide dismutase and catalase genes: functional study in Hong Kong Chinese asthma patients

BACKGROUND: Reactive oxygen species may contribute to the pathogenesis of asthma. Functional genetic polymorphisms of antioxidant enzymes, superoxide dismutase (SOD) and catalase are good candidates for asthma susceptibility. OBJECTIVE: To investigate the association of the manganese-containing form of SOD (MnSOD) gene at amino acid position 16 (Val16Ala) and catalase gene in the promoter at A-21T and C-262T polymorphisms and asthma in a Hong Kong Chinese population. METHODS: The association study was conducted in a case-control design in asthma patients (n=251) and healthy controls (n=316) by genotyping. The functional significance was assessed by determining erythrocyte SOD and catalase activity. RESULTS: The Val allele of MnSOD at Val16Ala and the A allele of catalase gene at A-21T were not different between patients and controls, while the C allele of catalase gene at C-262T was found to be significantly different between patients and controls (P=0.033). The less frequent variant of catalase gene (-262T) was found to be protective from the development of asthma in a Hong Kong Chinese non-smoking population (adjusted odds ratio=0.35, 0.15-0.85; P=0.017). Asthma patients had elevated erythrocyte SOD and catalase activities in comparison with healthy controls (P<0.01). However, their activities were not associated with different genotypes within healthy controls or asthma patients. CONCLUSION: This is the first report showing that SOD and catalase functional activities are not associated with their respective genetic polymorphisms but related to the presence of asthma in a Hong Kong Chinese population.     

Nucleotide changes around the splicing acceptor of intron 24 in the factor VIII gene and its impact on splicing.

Nucleotide 6724 of the factor VIII gene harbors a polymorphism of low frequency. A report from Taiwan claimed that 97.9% of the 83 alleles examined were of the A nucleotide at this position, which is quite different to the data from Western populations. Furthermore, this nucleotide is the start of exon 25, located in juxtaposition to the splicing acceptor of intron 24. We wonder if the nucleotide change at this location might have any effect on the splicing process of pre-mRNA. Using genomic DNA with direct sequencing of the polymerase chain reaction-amplified intron 24/exon 25 junction site, we found that 59 of the 60 patient samples were of the GTG sequence at nucleotides 6724-6726. The polymorphism is similar between populations in Taiwan and Western countries. The sequence of intron 24 around the splicing acceptor was always TCCAACTCTATTGCCCTCAG (-20 to -1), except for one hemophiliac patient who had a mutation in which the absolute consensus AG doublet of the intron 24 splicing acceptor changed to the AA dinucleotide. Owing to the mutation, exon 24 was erroneously spliced to exon 26, and exon 25 was skipped. This finding further testifies to the importance of the invariant AG dinucleotide in the example of the factor VIII gene.