Regulated recruitment of HP1 to a euchromatic gene induces mitotically heritable,epigenetic gene silencing: a mammalian cell culture model of gene variegation

Heterochromatin protein 1 (HP1) is a key component of constitutive heterochromatin in Drosophila and is required for stable epigenetic gene silencing classically observed as position effect variegation. Less is known of the family of mammalian HP1 proteins, which may be euchromatic, targeted to expressed loci by repressor-corepressor complexes, and retained there by Lys 9-methylated histone H3 (H3-MeK9). To characterize the physical properties of euchromatic loci bound by HP1, we developed a strategy for regulated recruitment of HP1 to an expressed transgene in mammalian cells by using a synthetic, hormone-regulated KRAB repression domain. We show that its obligate corepressor, KAP1, can coordinate all the machinery required for stable gene silencing. In the presence of hormone, the transgene is rapidly silenced, spatially recruited to HP1-rich nuclear regions, assumes a compact chromatin structure, and is physically associated with KAP1, HP1, and the H3 Lys 9-specific methyltransferase, SETDB1, over a highly localized region centered around the promoter. Remarkably, silencing established by a short pulse of hormone is stably maintained for >50 population doublings in the absence of hormone in clonal-cell populations, and the silent transgenes in these clones show promoter hypermethylation. Thus, like variegation in Drosophila, recruitment of mammalian HP1 to a euchromatic promoter can establish a silenced state that is epigenetically heritable.     

Postextrasystolic potentiation does not distinguish ischaemic from stunned myocardium

Myocardial function is impaired by ischaemia, and it remains depressed during reperfusion following short periods of ischaemia (stunned myocardium). We tested whether ischaemic and reperfusion dysfunction, in particular the time course of its recovery, can be distinguished by postextrasystolic potentiation (PESP). In eight open-chest dogs, posterior systolic wall thickening (sonomicrometry) was reduced by graded occlusion of the left circumflex coronary artery (LCX) from 17.4±6.8% (SD) during control conditions to 10.7±1.3% (mild ischaemic dysfunction), 7.2±2.3% (moderate ischaemic dysfunction), 3.6±1.4% (severe ischaemic dysfunction), and -4.4±3.6% (complete coronary occlusion). Extrasystoles with constant prematurity and a fully compensated postextrasystolic interval were induced after at least 4 min steady-state ischaemia. After each ischaemic period full recovery of posterior systolic wall thickening was assured. During 8 h of reperfusion following a 15-min LCX occlusion, extrasystoles were induced when posterior systolic wall thickening was comparable to one degree of the preceding ischaemic dysfunction. The increases in posterior systolic wall thickening induced by PESP were 10.5±5.8% during control conditions, during ischaemia they were 11.5±3.5% (mild dysfunction), 12.3±4.6% (moderate dysfunction), 12.6±4.1% (severe dysfunction) and 10.4±4.4% (complete coronary occlusion), and during reperfusion they were 12.8±8.2% (severe dysfunction), 13.0±9.7% (moderate dysfunction) and 10.7±2.2% (mild dysfunction). These increments in systolic wall thickening as well as those in ejection thickening were not significantly different. PESP can thus not distinguish between ischaemic and reperfusion dysfunction nor between different degrees of myocardial dysfunction.This study was supported by the Deutsche Forschungsge-meinschaft (He 1320/3-2). cand. med. S. Schäfer was involved in some of these experiments and presented part of the data at the 56th Annual Meeting of the Deutsche Gesellschaft für Herz- und Kreislaufforschung in Mannheim (Z Kardiol 79 [Suppl 1]: 24,1990). Part of the data were also presented at the 11th Congress of the European Society of Cardiology in Nice (Eur Heart J 10 [Suppl]: 242, 1989) and at the 73rd Annual Meeting of the Federation of American Societies for Experimental Biology in New Orleans (FASEB J 3: A841, 1989)     

Characterization of a reduced peptide bond analogue of a promiscuous CD4 T cell epitope derived from the Plasmodium falciparum malaria vaccine candidate merozoite surface protein 1

Use of synthetic peptides as vaccine components is hampered by their susceptibility to enzymatic degradation and rapid clearance from biological fluids. Introduction of non-natural structural modifications can render peptides more resistant to enzymatic degradation, encouraging attempts to profile such non-natural ligands as components of synthetic sub-unit vaccines. We have compared the antigenic and immunogenic properties of a series of non-natural peptide analogues derived from a promiscuous T cell epitope of the major Plasmodium falciparum malaria vaccine candidate merozoite surface protein 1 (MSP-1). A series of HLA class II restricted MSP-1(38-58)-specific TCC established from three volunteers were characterized for their minimal epitope and fine specificity. T cell stimulatory activities of a series of pseudo-peptide analogues with single reduced peptide bond Psi-[CH2-NH] modifications were compared with those of single d-amino acid replacement analogues. Compared to reduced peptide bond analogues the single d-amino acid replacement analogues turned out to be less suitable for stimulation of TCC. In particular, the reduced peptide analogue carrying a Psi-[CH2-NH] backbone modification between positions V52 and L53 of MSP-1(38-58) demonstrated properties that would make it a more suitable vaccine component than the unmodified parent peptide. First, the pseudo-peptide stimulated a number of TCC restricted by a range of HLA class II alleles. Second, trypsin treatment in combination with T cell stimulation assays provided evidence for increased resistance to proteolytic digestion. Third, the parasite-binding anti-MSP-1 mAb 7.27 recognized best this particular pseudo-peptide in competition ELISA experiments and its immunogenicity in out-bred Aotus monkeys was superior to that of the parent peptide eliciting antibodies cross-reactive with native MSP-1.     

Terminal sequences of Sindbis virus-specific nucleic acids: Identity in molecules synthesized in vertebrate and insect cells and characteristic properties of the replicative form RNA

The terminal sequences of the virus-specific nucleic acids synthesized in BHK vertebrate cells and in Aedes albopictus insect cells infected with the alphavirus Sindbis virus have been analyzed. The 26 S and 42 S plus-strand RNA molecules have the 5′-terminal sequences m⁷GpppAUAG and m⁷GpppAUAGGCGGCGUAGUACACAC, respectively. A 22 S replicative form (RF) RNA which contains an infectious 42 S plus-strand genome RNA molecule and a complementary 42 S negative-strand RNA accumulates in infected cells. The 5′-terminal sequence of the 42 S plus-strand RNA component of the RF is identical to that of the single-stranded plus-strand 42 S RNA molecule except for the absence of a 5′-terminal cap in the constituent of the RF RNA. The identification of a poly(U) sequence at the 5′-terminus of the 42 S minus strand RNA in our experiments is in accordance with earlier results obtained in other laboratories (Sawicki and Gomatos, 1976; Frey and Strauss, 1978). Analogous to our data concerning the structure of the RF RNA of the alphavirus Semliki Forest virus (Wengler et al., 1979) the 3′-terminus of the 42 S minus strand RNA component of the Sindbis virus-specific RF RNA is complementary to the 5′-terminus of the 42 S plus strand RNA molecule but in addition contains a 3′-terminal extra unpaired guanosine residue. The 3′-terminal sequence of the 42 S minus strand is strongly conserved between the two alphaviruses, Sindbis virus and Semliki Forest virus. The terminal sequences of the RF RNA synthesized in BHK and Aedes albopictus cells are identical. Analyses of the capped oligonucleotides derived from virus-specific single-stranded 42 S plus-strand RNA and from 26 S RNA strongly indicate that no base sequence differences exists between the corresponding molecules synthesized in either vertebrate or insect cells. Possible implications of these findings concerning the structure of alphavirus RF RNA and the synthesis of alphavirus-specific nucleic acids are discussed.     

Neurological Manifestations of COVID-19 Feature T Cell Exhaustion and Dedifferentiated Monocytes in Cerebrospinal Fluid

1. Download : Download high-res image (177KB)
2. Download : Download full-size image

     

Blood Polymorphonuclear Leukocyte Activation in Atherosclerosis: Effects of Aspirin

The aim of the study was to demonstrate an activation of polymorpho-nuclear leukocytes (PMNs) in chronic progressive atherosclerosis (ATH). A group of patients with ATH, and a group of ATH patients under aspirin (ASA) therapy were compared with control persons without atherosclerotic alterations (healthy controls). Each group comprised 15 male age-matched subjects. The following inflammatory parameters related to PMN activities were measured: the polymorphonuclear leukocyte (PMN) blood count; blood PMN migration and reactive oxygen species release in vitro; the blood levels of PMN elastase, malondialdehyde, antibodies to oxidized LDL and soluble ICAM-1. In ATH patients, the PMN blood counts and the share of blood PMNs migrating upon platelet activating factor and leukotriene B4 stimulation were significnatly above the values of the healthy controls, while the other parameters were not significantly altered. ASA treatment attenuated the inflammatory response and reduced the differences between ATH and the healthy controls. It can be concluded that, in patients with chronic progressive atherosclerosis, PMNs are involved in the inflammatory process underlying the disease.     

β1-Adrenoceptor gene variations: a role in idiopathic dilated cardiomyopathy?

A substantial body of evidence suggests involvement of the human beta1-adrenoceptor (beta1-AR) gene in the pathophysiology of dilated cardiomyopathy (DCM), a severe heart disease of significant public health impact. Beta1-AR-mediated signal transduction is dramatically altered due to downregulation, resulting in an impairment of myocardial response. The important role of genetic factors in idiopathic dilated cardiomyopathy (IDCM) recently recognized, we analyzed this prime candidate gene for genetic variation in carefully selected patients and controls. In this preliminary study, 18 single nucleotide polymorphisms were observed, 17 of which were located in the N-terminal and C-terminal region of the coding exon, resulting in 7 amino acid exchanges: Ser-49-Gly, Ala-59-Ser, Gly-389-Arg, Arg-399-Cys, His-402-Arg, Thr-404-Ala, and Pro-418-Ala. These mutations resulted in 11 different beta1-AR genotypes. Importantly, the genotypes carrying the Ser-49-Gly mutation in the N-terminus of the molecule in a heterozygous or homozygous form were observed significantly more frequently in the group of IDCM patients. The present results may provide a clue on the molecular mechanisms involved in IDCM, and add moreover interesting information on nature, distribution, and evolutionary aspects of sequence variation in human adrenergic receptor genes.     

Risk Factors and Management of Leukopenia After Kidney Transplantation: A Single-Center Experience

BackgroundLeukopenia is a common complication after kidney transplantation. The etiology is multifactorial, with medication adverse effects and cytomegalovirus infection as main causes. Optimal strategies to prevent or treat posttransplant leukopenia remain unknown. We aimed to identify risk factors for leukopenia and to investigate the benefit of switching the immunosuppressive therapy to hydrocortisone as a continuous infusion.MethodsWe retrospectively evaluated all patients with leukopenia after kidney transplantation between 2007 and 2017 at our center relative to age- and sex-matched controls.ResultsLeukopenia was associated with the degree of rejection therapy before leukopenia, the immunosuppressive therapy before transplantation, and an induction therapy with rabbit antithymocyte globulin. Patients with leukopenia exhibited increased mortality, an increased incidence of bacterial and viral infections, and more acute rejections. Switching to hydrocortisone as a continuous infusion in patients with severe leukopenia decreased the duration of leukopenia and the incidence of subsequent viral infections, especially with cytomegalovirus.ConclusionLeukopenia is a risk factor for infectious complications and mortality, and it is associated with acute rejection. Switching immunosuppressive therapy to hydrocortisone as a continuous infusion is a safe approach to reduce the duration of leukopenia and the incidence of viral infections.     

Effects of 6-hydroxydopamine on pre- and post-junctional 5-HT1-like receptor-mediated responses in dog saphenous vein

Summary To investigate whether 5-HT₁-like receptor-mediated inhibition of adenosine 3 : 5-cyclic monophosphate (cyclic AMP) accumulation occurs in nerves or smooth muscle of saphenous vein, infusions of 6-hydroxydopamine (6-OHDA) were administered to dogs with the aim of inducing sympathetic nerve damage. The effects of 6-OHDA on other 5-HT₁-like receptor-mediated responses at the pre- and post-junctional level were investigated for comparison by studying 5-hydroxytryptamine (5-HT)-induced inhibition of ³H-noradrenaline release and contraction of smooth muscle respectively.Disruption of nerve function by 6-OHDA was revealed by the lack of catecholaminergic fluorescence and neurogenic contractile responses in saphenous veins from dogs treated with 6-OHDA. In addition, severe impairment of neuronal uptake mechanisms were apparent since basal efflux of ³H-noradrenaline, electrically-evoked release of ³H-noradrenaline and remaining ³H-noradrenaline content were considerably reduced. Some ³H-noradrenaline was taken up and released in 6-OHDA treated tissues which is consistent with the existence of nerve varicosities resistant to the present dosing regime of 6-OHDA, an observation substantiated by electron microscopy studies showing inconsistent lesions of nerve terminals.6-OHDA pre-treatment potentiated the smooth muscle contractile responses mediated by 5-HT₁-like receptors as well as potentiating 5-HT-evoked inhibition of prostaglandin E₂-stimulated cyclic AMP accumulation. It did not, however, affect 5-HT-induced inhibition of ³H-noradrenaline release. The present results suggest that inhibition of cyclic AMP accumulation by 5-HT occurs predominantly in smooth muscle. Correspondence to A. J. Kaumann at the above address