Comparison of three methods to measure absolute cerebral hemoglobin concentration in neonates by near-infrared spectrophotometry

Three methods by which to determine absolute total cerebral hemoglobin concentration (tHb in micromol/L) by near-infrared spectrophotometry (NIRS) have evolved: (1) tHbo, requiring oxygenation changes and arterial oxygen saturation measurements as a reference using a relative NIRS algorithm, (2) tHbg, using a geometrical multidistance principle and (3) tHbgo, a combination of both. The aim of this study was to compare the three methods quantitatively. Sixteen clinically stable preterm infants with a mean gestational age of 29.6 (range of 25.1-36.4) weeks, birthweight of 1386 (680-2820) g and a postnatal age of 2.5 (0.5-6) days, who needed supplemental oxygen, were enrolled. The mean+/-standard deviation tHbg was 150.2+/-41.8 micromol/L (range of 61.6-228.9 micromol/L), the tHbo was 62.1+/-27.2 micromol/L (26.0-110.8 micromol/L) and the tHbgo was 89.3+/-45.6 micromol/L (26.5-195.9 micromol/L). The correlation coefficient among the three methods were tHbg and tHbgo r=0.736; tHbo and tHbgo r=0.938; tHbg and tHbo r=0.598. A multiple regression with variable selection by Mellow's C(p) showed, that tHbg was correlated to the birthweight, the postnatal age, the heart rate and the pCO2 (r(2)=0.588), tHbo and tHbgo were associated with the hemoglobin concentration in the blood, the mean arterial blood pressure and the pCO2 (r(2)=0.493 and 0.406, respectively). The three methods (tHbg, tHbo, and tHbgo) give systematically different tHb readings and large intersubject variability.     

Nutrient signalling in the regulation of human muscle protein synthesis

The mammalian target of rapamycin (mTOR) and AMP-activated protein kinase (AMPK) are important nutrient- and energy-sensing and signalling proteins in skeletal muscle. AMPK activation decreases muscle protein synthesis by inhibiting mTOR signalling to regulatory proteins associated with translation initiation and elongation. On the other hand, essential amino acids (leucine in particular) and insulin stimulate mTOR signalling and protein synthesis. We hypothesized that anabolic nutrients would be sensed by both AMPK and mTOR, resulting in an acute and potent stimulation of human skeletal muscle protein synthesis via enhanced translation initiation and elongation.
We measured muscle protein synthesis and mTOR-associated upstream and downstream signalling proteins in young male subjects ( n = 14) using stable isotopic and immunoblotting techniques. Following a first muscle biopsy, subjects in the 'Nutrition' group ingested a leucine-enriched essential amino acid–carbohydrate mixture (EAC). Subjects in the Control group did not consume nutrients. A second biopsy was obtained 1 h later. Ingestion of EAC significantly increased muscle protein synthesis, modestly reduced AMPK phosphorylation, and increased Akt/PKB (protein kinase B) and mTOR phosphorylation ( P < 0.05). mTOR signalling to its downstream effectors (S6 kinase 1 (S6K1) and 4E-binding protein 1 (4E-BP1) phosphorylation status) was also increased ( P < 0.05). In addition, eukaryotic elongation factor 2 (eEF2) phosphorylation was significantly reduced ( P < 0.05). Protein synthesis and cell signalling (phosphorylation status) was unchanged in the control group ( P > 0.05).
We conclude that anabolic nutrients alter the phosphorylation status of both AMPK- and mTOR-associated signalling proteins in human muscle, in association with an increase in protein synthesis not only via enhanced translation initiation but also through signalling promoting translation elongation.     

Neuronal Cell Death in Scrapie-Infected Mice Is Due to Apoptosis

Neuronal loss is a salient yet poorly understood feature in the pathology of transmissible spongiform encephalopathies (prion diseases). Cell culture experiments with neurotoxic prion protein fragments suggest that neuronal cell death in these diseases may be due to apoptosis. To test this hypothesis in vivo we used the in situ end-labeling (ISEL) technique and electron microscopy to study cell death in an experimental scrapie system in the mouse. ISEL, which relies on the incorporation of labeled nucleotides in fragmented DNA by terminal transferase, showed labeled nuclei in the brains and retinae of mice infected with the 79A strain of scrapie, whereas no labeling was observed in control animals. In the retina the highest numbers of labeled nuclei were found in the outer nuclear layer 120 days post infection followed by massive cell loss in this layer. In the brain, labeled nuclei were mainly found in the granular layer of the cerebellum of terminally ill mice. This corresponded to the presence of small dark nuclei with condensed and occasionally fragmented chromatin at the light and electron microscopical levels. Our results support the hypothesis that neuronal loss in spongiform encephalopathies is due to apoptosis. This may explain the almost complete absence of inflammatory response in prion diseases in the face of widespread neuronal cell death, and may also have therapeutic implications in the future.     

Fluorescence in situ hybridization reveals closely correlated results in cytological and histological specimens of hematological neoplasias compared to conventional cytogenetics.

OBJECTIVES: Fluorescence in situ hybridization (FISH) has become a useful tool to identify chromosomal aberrations in non-dividing cells. Numerous studies have compared chromosomal banding analysis (CBA) and FISH on fixed cultured bone marrow cells. However, up to now, there has been no study comparing two main sources of diagnostic material, i.e. bone marrow aspirates and trephine biopsies. We therefore analyzed these materials by FISH in comparison with CBA. METHODS: CBA revealed chromosomal aberrations in 18 patients suffering from myelodysplastic syndrome (n = 13), acute myeloid leukemia (n = 3), or chronic myeloproliferative syndrome (n = 2). FISH was performed on fixed cultured bone marrow cells, aspirates and trephine biopsies from each patient. RESULTS: Percentages of aberrant cells in the different materials correlated highly with Pearson values of 0.909 for biopsy/fixed cultured cells (p < 0.001), 0.830 for biopsy/aspirate (p < 0.001) and 0.768 for aspirate/fixed cultured cells (p < 0.001). Moreover, in bone marrow biopsies peritrabecular and central intertrabecular areas yielded very similar FISH results with a high correlation (r = 0.968, p < 0.001). FISH revealed a lower proportion of aberrant cells than CBA in 90% of the specimens. CONCLUSIONS: In summary, the different materials available for the FISH examination are comparable in sensitivity and show similar quantitative results. Therefore, the use of biopsy sections for the routine FISH examination of chromosomal abnormalities is a valid method.     

Knowledge about asthma and COPD: associations with sick leave, health complaints, functional limitations, adaptation, and perceived control

We sought to investigate associations between knowledge about the disease and sick leave, health complaints, functional limitations, adaptation and perceived control. Patients with asthma (n = 101) and COPD (n = 64) underwent lung function tests and completed questionnaires. In addition, all were asked the question: ‘what is the diagnosis of your disease?’, with the response categories: ‘asthma’ and ‘COPD (chronic bronchitis or emphysema)’. Thirty-five percent of the asthma patients and 30% of the COPD patients did not know their correct diagnosis. Sick leave was not associated with knowledge about the disease in asthma and COPD. In asthma, much knowledge about management of the disease was associated with better adaptation (P = 0.01) and less perceived control over health by external factors (P = 0.02). Knowing the correct diagnosis was associated with less control over health by powerful others (P = 0.02). For COPD, more knowledge about management of the disease was associated with better adaptation (P = 0.02) and less control over health by internal factors (P = 0.01). Knowing the correct diagnosis was associated with less control over dyspnea at work (P = 0.01).     

Advanced 1H Solid‐State NMR Spectroscopy on Hydrogels, 1

Summary: The nature of the pH dependent collapse of poly(methacrylic acid) (PMAA) hydrogels is investigated using recent ¹H solid‐state NMR methods. In aqueous solution, PMAA changes from an expanded conformation at high pHs to a compact contracted form at low pHs, where hydrogen bonds play a central role. In solid‐state ¹H NMR spectra, recorded under fast magic angle spinning (MAS), dried PMAA samples previously collapsed at low pHs show characteristic signals in the spectral region of the carboxylic acid protons. With the aid of 2D ¹H‐¹H double‐quantum (DQ) MAS NMR spectra, three signals can be distinguished at 8, 10.5 and 12.5 ppm, which are attributed to free carboxylic groups and two different types of hydrogen bonded forms, respectively. The 12.5 ppm signal arises from the hydrogen bond with the shortest H? H distance, corresponding to the form that is most stable with respect to increasing temperature and pH. The weaker hydrogen‐bonded form (with a signal at 10.5 ppm) requires a slightly lower pH, while the free acid signal (at 8 ppm) emerges under the most acidic medium. Moreover, the stabilities of the hydrogen‐bonded carboxylic acid dimers can be inferred from the proton‐proton distances within the dimers, i.e. (275 ± 5) pm and (295 ± 15) pm for the protons at 12.5 and 10.5 ppm, respectively, which are determined by means of DQ MAS sideband patterns. Both the stability of the hydrogen bonds and the acidity of the protons may be related to the stereochemistry and the conformation of the PMAA chains.

     

Practical Evaluation of Methods for Detection and Specificity of Autoantibodies to Extractable Nuclear Antigens

Detection and specificity of autoantibodies against extractable nuclear antigens (ENA) play a critical role in the diagnosis and management of autoimmune disease. Historically, the detection of these antibodies has employed double immunodiffusion (DID). Autoantibody specificity was correlated with diagnoses by this technique. Enzyme immunoassays have been developed by multiple manufacturers to detect and identify the specificity ENA autoantibodies. To address the relationship of ENA detection by DID and enzyme immunoassay, the performances of five immunoassays were compared. These included two DID and three enzyme-linked immunoassays (ELISA) (both screening and individual antigen profile kits). The sample set included 83 ENA-positive, antinuclear-antibody (ANA)-positive specimens, 77 ENA-negative, ANA-positive specimens, and 20 ENA- and ANA-negative specimens. Sensitivity and specificity were calculated by two methods: first, by using the in-house DID result as the reference standard, and second, by using latent class analysis, which evaluates each kit result independently. Overall, the results showed that the ELISA methods were more sensitive for detection of ENA autoantibodies than DID techniques, but presence and/or specific type of ENA autoantibody did not always correlate with the patient''s clinical presentation. Regardless of the testing strategy an individual laboratory uses, clear communication with the clinical staff regarding the significance of a positive result is imperative. The laboratory and the clinician must both be aware of the sensitivity and specificity of each testing method in use in the clinical laboratory.A diagnosis of autoimmune disease in patients is based upon clinical history, physical examination, and laboratory detection of antinuclear antibodies (ANAs). A particular class of ANAs specific for extractable nuclear antigens (ENA) was initially described in 1959 (3). Since that time, many different anti-ENA antibodies have been described. The detection of these autoantibodies and identification of their specificity have become well-established tools for the laboratory diagnosis of several autoimmune diseases. Studies of patients with ENA antibodies have shown that detection of these autoantibodies may have both diagnostic and prognostic significance, and the detection of anti-ENA antibodies has assumed an important role in the management of these patients (5, 16, 22). In most cases, ENA testing is ordered after an initial ANA screen. The indications for use are to establish a diagnosis in patients with suggestive clinical symptoms, to exclude a diagnosis of autoimmune disease in patients with few or uncertain clinical signs, to subclassify patients with a known diagnosis, and to monitor disease activity.Testing for anti-ENA antibodies has historically relied on gel-based immunoprecipitation techniques such as double immunodiffusion (DID) and counterimmunoelectrophoresis (2, 14). The associations of specific types of ENA autoantibodies with rheumatological diseases were established by using these gel-based immunoassay techniques (15). In the last decade, enzyme-linked immunoassay (ELISA) systems have been developed to detect and determine the specificity of anti-ENA antibodies. ELISA systems permit more rapid processing of more specimens with a faster turnaround time than gel-based assays. ELISA-based methods may also have increased sensitivity for detection of ENA antibodies. However, the increased sensitivity of these ELISAs may influence the clinical relevance of their detection because diagnostic specificity may be reduced (10, 12, 17, 24). As yet, a set of reference standards with known antibody specificities against defined antigen preparations is not available for evaluation of various methods or kits. Serum reference panels are available from the Association of Medical Laboratory Immunologists (4), but the specificities of these sera were determined by consensus results from multiple laboratories. The purpose of this study was to address the relationship between DID and ELISA methods for the detection and identification of anti-ENA antibodies by evaluating and comparing two DID kits and three ELISA kits. We evaluated both screening ELISAs and monospecific antigen ELISAs to determine anti-ENA specificity.     

Isolation of human immunodeficiency virus (HIV) from plasma during primary HIV infection

Human immunodeficiency virus (HIV) has been isolated from plasma in 6 of 7 patients showing clinical symptoms of a primary HIV infection. Parallel cultures from peripheral blood mononuclear cells (PBMC) yielded virus in 5 patients. In one case, virus could only be isolated from the cerebrospinal fluid but not from peripheral blood. Detectable viremia was transient and preceded the appearance of HIV specific antibodies. After cessation of acute symptoms, the frequency of HIV isolations was similar to that of asymptomatic carriers (23 and 26%, respectively). The role of the immune response in terminating detectable viremia remains to be established.     

Terminal sequences of Sindbis virus-specific nucleic acids: Identity in molecules synthesized in vertebrate and insect cells and characteristic properties of the replicative form RNA

The terminal sequences of the virus-specific nucleic acids synthesized in BHK vertebrate cells and in Aedes albopictus insect cells infected with the alphavirus Sindbis virus have been analyzed. The 26 S and 42 S plus-strand RNA molecules have the 5′-terminal sequences m⁷GpppAUAG and m⁷GpppAUAGGCGGCGUAGUACACAC, respectively. A 22 S replicative form (RF) RNA which contains an infectious 42 S plus-strand genome RNA molecule and a complementary 42 S negative-strand RNA accumulates in infected cells. The 5′-terminal sequence of the 42 S plus-strand RNA component of the RF is identical to that of the single-stranded plus-strand 42 S RNA molecule except for the absence of a 5′-terminal cap in the constituent of the RF RNA. The identification of a poly(U) sequence at the 5′-terminus of the 42 S minus strand RNA in our experiments is in accordance with earlier results obtained in other laboratories (Sawicki and Gomatos, 1976; Frey and Strauss, 1978). Analogous to our data concerning the structure of the RF RNA of the alphavirus Semliki Forest virus (Wengler et al., 1979) the 3′-terminus of the 42 S minus strand RNA component of the Sindbis virus-specific RF RNA is complementary to the 5′-terminus of the 42 S plus strand RNA molecule but in addition contains a 3′-terminal extra unpaired guanosine residue. The 3′-terminal sequence of the 42 S minus strand is strongly conserved between the two alphaviruses, Sindbis virus and Semliki Forest virus. The terminal sequences of the RF RNA synthesized in BHK and Aedes albopictus cells are identical. Analyses of the capped oligonucleotides derived from virus-specific single-stranded 42 S plus-strand RNA and from 26 S RNA strongly indicate that no base sequence differences exists between the corresponding molecules synthesized in either vertebrate or insect cells. Possible implications of these findings concerning the structure of alphavirus RF RNA and the synthesis of alphavirus-specific nucleic acids are discussed.     

Lymphocytic choriomeningitis virus

Lymphocytic choriomeningitis (LCM) virus-specific complement-fixing (CF) antigen (ECFA) has been solubilized, concentrated, and partially purified. When inoculated together with Freund's adjuvant, ECFA induced CF antibody but not neutralizing antibody or protective immunity. By itself it boosted pre-existing CF antibody but not neutralizing antibody. In double diffusion tests one line developed between ECFA and its antiserum, and a corresponding line became visible when ECFA interacted with an antiserum directed against all LCM virus-specific antigens. Absorption of either serum with ECFA abolished all ECFA-precipitating qualities. Ouchterlony tests also revealed that ECFA prepared from cells and tissues of various species is immunologically identical. By a variety of procedures ECFA was not found to be represented on the surface of either the virion or the infected cell. When purified infectious LCM virus was disrupted, a CF antigen corresponding immunologically to ECFA was set free. In double diffusion tests this antigen gave a line of identity with ECFA. Thus, ECFA appears to be an internal component of the infectious LCM virus.Part of the work reported here has been published in preliminary communications [8, 10, 24, 25].