Tamoxifen prevents recurrence of breast cancer and is suggested for preventive risk-reducing therapy. Tamoxifen reduces mammographic density, a proxy for therapy response, but little is known about its effects in remodelling normal breast tissue. Our study, a substudy within the double-blinded dose-determination trial KARISMA, investigated tamoxifen-specific changes in breast tissue composition and histological markers in healthy women. We included 83 healthy women randomised to 6 months daily intake of 20, 10, 5, 2.5, 1 mg of tamoxifen or placebo. The groups were combined to “no dose” (0-1 mg), “low-dose” (2.5-5 mg) or “high-dose” (10-20 mg) of tamoxifen. Ultrasound-guided biopsies were collected before and after tamoxifen exposure. In each biopsy, epithelial, stromal and adipose tissues was quantified, and expression of epithelial and stromal Ki67, oestrogen receptor (ER) and progesterone receptor (PR) analysed. Mammographic density using STRATUS was measured at baseline and end-of-tamoxifen-exposure. We found that different doses of tamoxifen reduced mammographic density and glandular-epithelial area in premenopausal women and associated with reduced epithelium and increased adipose tissue. High-dose tamoxifen also decreased epithelial ER and PR expressions in premenopausal women. Premenopausal women with the greatest reduction in proliferation also had the greatest epithelial reduction. In postmenopausal women, high-dose tamoxifen decreased the epithelial area with no measurable density decrease. Tamoxifen at both low and high doses influences breast tissue composition and expression of histological markers in the normal breast. Our findings connect epithelial proliferation with tissue remodelling in premenopausal women and provide novel insights to understanding biological mechanisms of primary prevention with tamoxifen. 相似文献
Introduction: Percutaneous renal mass biopsy has evolved over the last decade with improvements on previous pitfalls including low tissue yield, high non-diagnostic rates, and complications. As understanding of tumor biology and natural history of renal cortical neoplasms has improved, percutaneous renal mass biopsy is poised to have an expanding role in an area characterized by individualized management and refined risk stratification.
Areas covered: This review summarizes the evolution of renal mass biopsy to its current state with respect to outcomes, indications, and clinical guidelines.
Expert opinion: With improved understanding of differential biological potential of renal cortical neoplasms combined with technical improvements in diagnostic yield and accuracy, utilization of renal mass biopsy is becoming an important adjunct to patient care in a broad range of clinical scenarios, including active surveillance, thermal ablation, and use of primary systemic therapy in localized and advanced settings. 相似文献
Background: Aniridia is a rare developmental eye disorder characterized by complete or partial iris hypoplasia often accompanied with other ocular changes that affect the cornea, anterior chamber, lens, retina, and optic nerve. Most cases of aniridia are inherited with an autosomal dominant mode of inheritance caused by PAX6 mutations or deletions. To reveal the underlying genetic defect in a four-generation Iranian family with aniridia, we carried out a genetic screening of PAX6.
Methods: Complete ophthalmic examinations were performed for available affected family members. All PAX6 exons and their flanking regions were sequenced for affected individuals. Candidate variation was screened for segregation in the pedigree by Sanger sequencing. Bioinformatics prediction was done to evaluate the deleterious effects of the mutation on protein product. Real-time PCR was used to investigate the impact of the variant on PAX6 mRNA expression.
Results: All patients were diagnosed with isolated aniridia associated with variable phenotypic features including retinal detachment. A novel heterozygous deletion c.320_348delTGTCCGAGGGGGTCTGTACCAACGATAAC (p.Leu107HisfsX16) on PAX6 gene was detected. Decreased mRNA level of PAX6 in the affected individuals indicated that the mutation caused nonsense-mediated mRNA decay (NMD).
Conclusions: To the best of our knowledge, it is the first report on the genetics of aniridia in Iran. Segregation analysis, bioinformatics prediction and confirmation of NMD, all support the proposition that the novel observed PAX6 mutation is the cause of aniridia in the pedigree. Retinal detachment in some of the affected members, which is a rare reported phenotypic feature of aniridia patients, may be associated with this mutation. 相似文献
A prompt and effective management of trauma patient is necessary. The aim of this case report is to highlight the importance of intraoperative echocardiography as a useful tool in patients suffering from refractory hemodynamic instability no otherwise explained.
Case report
A 41 year‐old woman suffered a car accident. At the emergency department, no abnormalities were found in ECG or chest X‐ray. Abdominal ultrasound revealed the presence of abdominal free liquid and the patient was submitted to urgent exploratory laparotomy. Nevertheless, she persisted suffering arterial hypotension and metabolic acidosis. Looking for the reason of her hemodynamic instability, intraoperative transthoracic echocardiography was performed, finding out the presence of pericardial effusion. Once the cardiac surgeon extracted pericardial clots, patient's situation improved clinically and analytically.
Conclusion
Every anesthesiologist should be able to use the intraoperative echocardiography as an effective tool in order to establish the appropriate measures to promote the survival of patients suffering severe trauma. 相似文献