Clinical and economic burden of infections in hospitalized solid organ transplant recipients compared with the general population in Canada – a retrospective cohort study

Infections continue to be a major cause of post‐transplant morbidity and mortality, requiring increased health services utilization. Estimates on the magnitude of this impact are relatively unknown. Using national administrative databases, we compared mortality, acute care health services utilization, and costs in solid organ transplant (SOT) recipients to nontransplant patients using a retrospective cohort of hospitalizations in Canada (excluding Manitoba/Quebec) between April‐2009 and March‐2014, with a diagnosis of pneumonia, urinary tract infection (UTI), or sepsis. Costs were analyzed using multivariable linear regression. We examined 816 324 admissions in total: 408 352 pneumonia; 328 066 UTI's; and 128 275 sepsis. Unadjusted mean costs were greater in SOT compared to non‐SOT patients with pneumonia [(C$14 923 ± C$29 147) vs. (C$11 274 ± C$18 284)] and sepsis [(C$23 434 ± C$39 685) vs. (C$20 849 ± C$36 257)]. Mortality (7.6% vs. 12.5%; P < 0.001), long‐term care transfer (5.3% vs. 16.5%; P < 0.001), and mean length of stay (11.0 ± 17.7 days vs. 13.1 ± 24.9 days; P < 0.001) were lower in SOT. More SOT patients could be discharged home (63.2% vs. 44.3%; P < 0.001), but required more specialized care (23.5% vs. 16.1%; P < 0.001). Adjusting for age and comorbidities, hospitalization costs for SOT patients were 10% (95% CI: 8–12%) lower compared to non‐SOT patients. Increased absolute hospitalization costs for these infections are tempered by lower adjusted costs and favorable clinical outcomes.     

Assessment of knowledge,attitude and practice regarding oxygen therapy at emergency departments in Riyadh in 2017: A cross-sectional study

BACKGROUND: Administering oxygen therapy (OT) has an essential role in preventing/managing hypoxemia in both acute and chronic conditions. It should be adjusted to achieve the normal oxygen saturation of 94%-98% in most cases. This study aims to evaluate knowledge, attitude and practice (KAP) of nurses, paramedics, emergency medical technicians (EMTs) and Emergency Medical Services (EMS) physicians working at emergency departments (ED) in Riyadh, Saudi Arabia. METHODS: In this cross-sectional study, a structured questionnaire was used to assess KAP related to OT of nurses, paramedics, EMTs and EMS physicians currently working at an ED of a tertiary care hospital. Knowledge and attitude were assessed using a Likert scale from 1-5, whereas practice was assessed as a yes/no categorical variable. RESULTS: A total of 444 emergency health-care workers (EHCWs) participated, of which 225 (50.7%) were male, with the majority (77%) in the age group of 20-35 years. Over half of the sample were nurses (266; 59.9%). The mean score for knowledge about OT was 5.51±1.45, attitude was 26.31±3.17 and for practices 4.55±1.76. The main factors which were associated with poor KAP were workload and lack of local guidelines. The distribution of overall practice score was significantly better among paramedics - nurses group and EMT - nurses group. CONCLUSION: This study demonstrates that there is a gap in EHCWs’ KAP, particularly regarding when to provide OT to a patient. This gap can affect patients’ safety. Extensive educational and training programs about OT are needed to raise awareness among health-care providers.     

Intrinsic Properties of Multi-Layer TiO2/V2O5/TiO2 Coatings Prepared via E-Beam Evaporation

Nanocomposite multi-layer TiO₂/V₂O₅/TiO₂ thin films were prepared via electron-beam evaporation using high-purity targets (TiO₂ and V₂O₅ purity > 99.9%) at substrate temperatures of 270 °C (TiO₂) and 25 °C (V₂O₅) under a partial pressure of oxygen of 2 × 10⁻⁴ mbar to maintain the stoichiometry. Rutherford backscattering spectrometry was used to confirm the layer structure and the optimal stoichiometry of the thin films, with a particle size of 20 to 40 nm. The thin films showed an optical transmittance of ~78% in the visible region and a reflectance of ~90% in the infrared. A decrease in transmittance was observed due to the greater cumulative thickness of the three layers and multiple reflections at the interface of the layers. The optical bandgap of the TiO₂ mono-layer was ~3.49 eV, whereas that of the multi-layer TiO₂/V₂O₅/TiO₂ reached ~3.51 eV. The increase in the optical bandgap was due to the inter-diffusion of the layers at an elevated substrate temperature during the deposition. The intrinsic, structural, and morphological features of the TiO₂/V₂O₅/TiO₂ thin films suggest their efficient use as a solar water heater system.     

Evaluation of pharmacy intern-led transition of care service at an academic hospital in Saudi Arabia: A prospective pilot study

ObjectivesThe transition of patients from one setting to another increases the risk of medication errors (MEs). This study aims to assess the implementation of pharmacy intern-led transition of care (TOC) service and to demonstrate its impact on the quality of patient care.MethodA prospective interventional pilot study was carried out from August 2020 to April 2021 at an academic hospital in Saudi Arabia. The TOC team consisted of three pharmacy interns and one pharmacist-in-charge. Daily activities included medication reconciliation, discharge counseling, and follow-up call after 3 days of discharge. The identified discrepancies were categorized according to the National Coordinating Council for Medication Error Reporting Program.Key findingsA total of 182 patients were included in the analysis. During medication reconciliation, 102 discrepancies were detected, with an average of 0.7 discrepancy per patient. The most common discrepancy at admission and discharge was omission (41.7% and 70%, respectively). Category B was the most frequent and accounted for 46% at admission and 93% at discharge. Around 39% of TOC beneficiaries received a follow-up call, and all reported a high level of satisfaction with the service.ConclusionInvolving the pharmacy team in TOC activities was effective in identifying discrepancies and resolving MEs.     

Association of sodium voltage-gated channel genes polymorphisms with epilepsy risk and prognosis in the Saudi population

BackgroundEpilepsy is a heterogeneous complex condition that involve the human brain. Genetic predisposition to epilepsy is a fundamental factor of the disorder aetiology. The sodium voltage-gated channel (SCN) genes variants are critical biomarker for the epilepsy development and progression. In this study, we aimed to investigate the association of several SNCs genetic polymorphisms with epilepsy risk and their intrudance of the disease prognosis.MethodsBlood samples were withdrawn from 296 Epilepsy patients in addition to 293 healthy matched participants prior to DNA extraction. PCR-sequencing was used for genotyping analysis. Genotyping outputs were then statistically analysed for genotype/phenotype evaluation.ResultsWithin SCN1A gene we found that the rs6432861 (p = 0.014) was in correlation with the risk of epilepsy. In addition, both rs4667485 and rs1469649 of SCN2A gene were significantly correlated to epilepsy risk for both allelic (4e-4 and 1e-3) and genotypic (1e-3 and 5e-3). Moreover, the haplotype analysis showed that the GATGCTCGGTTTCGCTACGCA haplotype of SCN2A gene was significantly related to epilepsy increased risk, p = 6e-3, OR (CI) = 2.02 (1.23–3.31). In relevant to our finding, many of the investigated SCNs variants in the current study were related to several clinical features of epilepsy.ConclusionIn light of our results, we infer that SCN genes polymorphisms are strong candidates for epilepsy development and progression. Furthermore, these variant are essential for the disorder prognosis and medications outcomes.

Key Messages

• Genetic polymorphisms of sodium channels SCN1A, SCN2A and SCN3A were found to be associated with the risk of epilepsy.
• SCN1B polymorphisms were found to be correlated to epilepsy reduced risk.
• SCNs variants are involved in the epilepsy prognosis and response to treatment.

     

Outcomes of Ahmed valve surgery for refractory glaucoma in Dhahran, Saudi Arabia

AIM:To evaluate the outcomes of Ahmed glaucoma valve (AGV) implantation surgery for refractory glaucoma.METHODS:This one-armed historical cohort study was conducted in 2011. Refractory glaucoma was defined as eyes with an intraocular pressure (IOP) greater than 21 mm Hg with maximally tolerated glaucoma medications, failed surgeries, or both. For all eyes with refractory glaucoma that underwent AGV implantation, data were collected on IOP, the best corrected visual acuity (BCVA) and glaucoma medications preoperatively and 4, 6, 12, 24 and 56wk postoperatively. Logarithm values of IOP were calculated and compared.RESULTS: The study group was comprised of 30 patients (30 eyes, 16 males and 14 females) with refractory glaucoma. Mean preoperative IOP was 39.3±13.8 mm Hg. Postoperative mean IOP was 15.7±7.1 mm Hg, 19.6±12.8 mm Hg and 13.9±14.2 mm Hg at 12, 24 and 56wk respectively. BCVA was ≥ 6/60 in 11 eyes preoperatively, and five eyes had BCVA≥6/60 at 56wk postoperatively. Preoperatively, more than four medications were used to treat glaucoma in 21 eyes. At 12wk postoperatively, no medications were required to control IOP in 20 eyes. At 56wk postoperatively, at least one medication was required to control IOP in 10 eyes. Over the entire follow up period, four eyes were treated with yttrium aluminium garnet (YAG) laser and 14 eyes required a second surgery. The AGV was removed in four eyes.CONCLUSION: AGV implantation reduced IOP and the number of medications required to control refractory glaucoma. However, there was a higher risk of decreased vision. Long-term follow up and prompt intervention are recommended.