Homozygous microdeletion of chromosome 4q11-q12 causes severe limb-girdle muscular dystrophy type 2E with joint hyperlaxity and contractures

Microdeletion syndromes are commonly transmitted as dominant traits and are frequently associated with variably expressed pleiotropic phenotypes. Nonlethal homozygous microdeletions, on the other hand, are very rare. Here, we delineate the fifth and so far largest homozygous microdeletion in nonmalignancies of approximately 400 kb on chromosome 4q11-q12 in a large consanguineous East-Anatolian family with six affected patients. The deleted region contains the beta-sarcoglycan gene (SGCB), the predicted gene SPATA18 (spermatogenesis associated 18 homolog) and several expressed sequence tags. Patients presented with a severe and progressive Duchenne-like muscular dystrophy phenotype, a combination of hyperlaxity and joint contractures, chest pain, palpitations, and dyspnea.     

Improvement of cytomegalovirus avidity testing by adjusting the concentration of CMV-specific IgG in test samples.

BACKGROUND: Human cytomegalovirus (CMV) is the most common cause of viral intrauterine infection. Primary CMV infection in early pregnancy bears a high risk of fetal damage. Accurate measurement of CMV-specific IgG avidity may help to improve the serodiagnosis of CMV-infected women by determining the time of infection and fetal outcome. OBJECTIVES: To study the performance of the CMV avidity assay with the fully automated Vidas analyzer (bioMérieux) as a function of the concentration of CMV-specific IgG present in the serum sample. STUDY DESIGN: Eighty-two serum samples were investigated from 3 clinical scenarios: 18 individuals with sera negative for CMV-specific IgG and IgM (control group), 20 pregnant women (44 samples) containing CMV-specific IgG- and IgM-antibodies suggesting acute or recent primary infection and 20 patients with evidence of past infection (CMV-IgG positive and CMV-IgM negative). RESULTS: In the group with presumed acute or recent primary infection 12 of 44 sera had CMV-specific IgG values above 100 arbitrary units (AU, bioMérieux)/ml and in these cases an increase in AI was measurable upon dilution of the serum sample. In two cases, AI's were shifted towards or above the cut-off value of AI>or=0.8, indicative of past infection. Dilution of sera which were CMV-specific IgM positive and had specific IgG concentrations of 相似文献   

Participation of serum and membrane lectins on the oxidative burst regulation in Macrobrachium rosenbergii hemocytes

Using a spectrophotometric NBT reduction assay and phagocytosis, we identified that production of superoxide anions and phagocytic activity of hemocytes from Macrobrachium rosenbergii were significantly higher in the presence of rat, rabbit, and chicken erythrocytes than with human, pig, or horse erythrocytes. Hemocytes stimulated with MrL, MrLMab, or PMA increased 4.7, 5.1, and 6.1 fold, respectively, the oxidative response as compared to non-stimulated hemocytes. MrLMab together with MrL increased 5.7 fold the oxidative capacity of hemocytes as compared to non-stimulated cells. These effects were inhibited with 100 mM GalNAc, GlcNAc, or Neu5Ac and 0.2 microM of sialylated submaxillary gland mucin and fetuin. Piroxicam inhibited (P < 0.05) the production of O(2)(-) induced by MrL, whereas iodoacetamide inhibited the effect of MrLMAb (P < 0.05) in a dose-dependent manner. Our results suggest that MrLMab might activate the oxidative burst through the metabolism of glucose as opposed to MrL which utilizes NADPH-independent mechanisms, very probably through pro-inflammatory metabolites.     

Terminal sequences of Sindbis virus-specific nucleic acids: Identity in molecules synthesized in vertebrate and insect cells and characteristic properties of the replicative form RNA

The terminal sequences of the virus-specific nucleic acids synthesized in BHK vertebrate cells and in Aedes albopictus insect cells infected with the alphavirus Sindbis virus have been analyzed. The 26 S and 42 S plus-strand RNA molecules have the 5′-terminal sequences m⁷GpppAUAG and m⁷GpppAUAGGCGGCGUAGUACACAC, respectively. A 22 S replicative form (RF) RNA which contains an infectious 42 S plus-strand genome RNA molecule and a complementary 42 S negative-strand RNA accumulates in infected cells. The 5′-terminal sequence of the 42 S plus-strand RNA component of the RF is identical to that of the single-stranded plus-strand 42 S RNA molecule except for the absence of a 5′-terminal cap in the constituent of the RF RNA. The identification of a poly(U) sequence at the 5′-terminus of the 42 S minus strand RNA in our experiments is in accordance with earlier results obtained in other laboratories (Sawicki and Gomatos, 1976; Frey and Strauss, 1978). Analogous to our data concerning the structure of the RF RNA of the alphavirus Semliki Forest virus (Wengler et al., 1979) the 3′-terminus of the 42 S minus strand RNA component of the Sindbis virus-specific RF RNA is complementary to the 5′-terminus of the 42 S plus strand RNA molecule but in addition contains a 3′-terminal extra unpaired guanosine residue. The 3′-terminal sequence of the 42 S minus strand is strongly conserved between the two alphaviruses, Sindbis virus and Semliki Forest virus. The terminal sequences of the RF RNA synthesized in BHK and Aedes albopictus cells are identical. Analyses of the capped oligonucleotides derived from virus-specific single-stranded 42 S plus-strand RNA and from 26 S RNA strongly indicate that no base sequence differences exists between the corresponding molecules synthesized in either vertebrate or insect cells. Possible implications of these findings concerning the structure of alphavirus RF RNA and the synthesis of alphavirus-specific nucleic acids are discussed.     

Identification of four novel melanocortin 1 receptor (MC1R) gene variants in a Mediterranean population

The melanocortin 1 receptor (MC1R) gene is a major determinant of human pigmentation and specific allelic variants have been associated with red hair and sun sensitive skin types as well as increased skin cancer risk in Caucasian individuals. We screened for allelic variants the entire MC1R coding region of 100 unrelated individuals sampled from an Italian population who has darker pigmentary traits than populations analyzed to date. Twenty MC1R variants were identified, eighteen located at non-synonymous sites and two at synonymous sites. We report four novel MC1R allelic variants: C35Y (g.104G>A), V38M (g.112G>A), L44V (g.130C>G) and I120T (g.359T>C).     

Über das regelmässige Vorkommen von Lipoproteiden im Harn des Gesunden

Journal of Molecular Medicine - Der Urin des Gesunden enthält regelmäßig kleine Mengen Eiweiß, die mit den üblichen Eiweißproben nicht nachweisbar sind. Es setzt sich,...     

A common beta ig-h3 gene mutation (delta f540) in a large cohort of Sardinian Reis Bücklers corneal dystrophy patients. Mutations in brief no. 180. Online

Reis-Bücklers' corneal dystrophy (RBCD) is a relatively rare autosomal dominant disease originating in the Bowman's membrane, which causes severe visual impairment. Recently RBCD, together with lattice corneal dystrophy type I (LCDI), granular corneal dystrophy (CDGG1) and Avellino stromal dystrophy (ASD), all mapped on 5q31, were found to be associated to four different mutations in the beta ig-h3 gene which codify for kerato-epithelin. We identified several cases of RBCD in Sardinia. We reconstructed through genealogical search two eight generation-families, originating from the same village (Arbus), indicating a common ancestor for RBCD in Sardinia. Linkage studies on these families confirmed the association of the disease with the 5q31 region. Sequence analysis of beta ig-h3 gene revealed a trinucleotide deletion in exon 12, corresponding to the loss of F540 in the protein sequence (delta F540). Our data describe a new mutation in the beta ig-h3 gene causing RBCD. This dominant negative mutation is located in the fourth internal repeat of kerato-epithelin which is a protein domain highly conserved across species. This suggests the basic role of this domain in maintaining the proper kerato-epithelin structure which when altered can cause the typical precipitates in the RBCD cornea.     

Effective antiretroviral therapy reduces degradation of tryptophan in patients with HIV-1 infection

Antiretroviral therapy (ART) has a significant impact on HIV-1 RNA levels, the CD4 cell count, and immune activation. We examined whether these changes are associated with a change in the rate of tryptophan degradation (expressed as the kynurenine to tryptophan ratio, kyn/trp) as an estimate for the activity of interferon-gamma inducible enzyme indoleamine (, )-dioxygenase (IDO). Plasma levels of tryptophan, kynurenine, and neopterin were measured pretherapy and 6 months postinitiation of therapy in 45 patients with HIV-1 RNA levels of less than 1000 copies/ml 6 months after initiation of ART. Before ART, the patients had decreased tryptophan and increased kynurenine concentrations compared to healthy controls. During ART, average tryptophan levels increased; in the same time kynurenine and kyn/trp decreased (P < 0.001), although not to normal levels. Since pretherapy tryptophan concentrations correlated inversely with neopterin, and kynurenine correlated with viral load and neopterin but not with CD4 cell count, the data support the view that HIV production may induce immune activation and consequently tryptophan is degraded at a higher rate. In agreement, kyn/trp positively correlated with neopterin (r(s) = 0.60, P < 0.001), with virus load (r(s) = 0.37, P = 0.013), and very weakly with CD4(+) cells counts (r(s) = 0.30, P = 0.049). The change in the kyn/trp ratio during ART correlated more strongly with the change in neopterin levels (r(s) = 0.49, P = 0.001) than with the change in HIV RNA levels and weakly with the CD4 cell count. The data underscore the fact that both neopterin production and tryptophan degradation are triggered by immune activation. Tryptophan degradation is increased in HIV infection and partially reversed under ART. The data agree with the concept that immune activation is the common background of IDO activation which may be an important factor underlying T-cell hyporesponsiveness.     

Faster gastric emptying for glucose-polymer and fructose solutions than for glucose in humans

Summary This study examined the rates of gastric emptying for water and 13 different carbohydrate-containing solutions in seven subjects, using conventional gastric intubation techniques. The rates of gastric emptying for water and a 10% glucose-polymer solution were also measured during 90 min of treadmill running at 75% of each subject's maximum oxygen consumption . At rest, 15% glucose-polymer (P) and fructose (F) solutions emptied more rapidly from the stomach and provided a faster rate of carbohydrate delivery than did a 15% glucose (G) solution (p<0.05). The G solutions showed a constant energy delivery rate of 3.3 kcal · min^–1; energy delivery from P and F solutions rose with increasing solution concentrations. The osmolality of the gastric aspirate predicted the rate of gastric emptying for all solutions (p<0.05) but overestimated rates of emptying for 10% and 15% P solutions and underestimated emptying rates for 10% and 15% F solutions. Exercise at 75% decreased the rate of gastric emptying of water but not of 10% P solutions. Thus the different rates of gastric emptying for different carbohydrate-containing solutions were not entirely explained by differences in osmolality. Furthermore, exercise may have different effects on the gastric emptying rates of water and carbohydrate solutions.