The Sit & Stand chair. A revolutionary advance in adaptive seating systems

A major factor governing independence for the elderly and persons with disabilities is the ability to stand from a chair. Factors such as pain, reduced joint range of motion, stiffness, and muscle weakness frequently limit the ability to stand. Sit-to-stand position is even further reduced in patients whose hands and shoulders are afflicted with rheumatoid arthritis. When achieving a sit-to-stand position in the elderly and persons with disabilities, there is considerable risk of the individual falling and sustaining bone fracture. The purposes of this scientific report are to achieve the following goals: (1) to provide a narrative discussion of the senior author's contributions to furniture manufacturing as well as his successful patent application for the SIT & STAND chair, (2) to describe the steps involved in the development of the SIT & STAND prototype, and (3) to examine the performance of the SIT & STAND chair in assisting the elderly or persons with disabilities in achieving a sit-to-stand position.The invention of the SIT & STAND chair by the senior author, Michael Galumbeck, was a culmination of his lifelong interest in adaptive seating systems. His electrically operated chair has the unique ability to assist the occupant to achieve safely a sit-to-stand position. The rear portion of his chair remains in a fixed position to support the buttocks of the user during mechanical lift. The front portion of the seat folds down incrementally as the chair rises to allow the feet of the user to be positioned in a more posterior position firmly on the floor. Using its actuator, the height that the chair rises will vary with the length of the legs of the occupant. Using the drawing program Solid Works (Solid Works, Concord, Massachusetts), drawings of the chair were made. To visualize the operation and performance of the chair, separate drawings were made in the lateral position. The prototype of the SIT & STAND chair was manufactured with an electric actuator that allows elevation of the back portion of the seat. The design of this chair ensured that there were no pinch points that could endanger the user or assistant. Its framework ensured that it was stable and did not tip over. After the prototype chair is manufactured, it is being sent to Underwriters Laboratory Inc. (Los Angeles, California) for review and certification. The performance of the SIT & STAND chair was determined in a clinical study involving seven elderly or disabled individuals who complained of difficulty in rising from a chair from a seated position. During each performance evaluation, a mechanical chest and shoulder harness attached to an overhead sling encircled the individual to ensure that he/she would not fall. In the first part of the evaluation, these individuals were asked to achieve a standing position after being seated in the SIT & STAND chair without the use of the actuator. Three individuals were unable to achieve a standing position, while four achieved this standing position with considerable difficulty and potential instability. When these participants used the SIT & STAND chair with the use of the electrical actuator, all individuals achieved a standing position without difficulty or instability. All individuals expressed disappointment that the SIT & STAND chair was not commercially available for them to purchase and use in their homes. Because the SIT & STAND chair allows the individual to achieve a standing position without assistance, the SIT & STAND chair has other potential benefits not evaluated in this study. The beneficial effects of standing have been documented by comprehensive scientific studies. These benefits include reduction of seating pressure, decreased bone demineralization, increased bladder pressure, enhanced circulatory regulation, reduction in muscular tone, decrease in upper extremity muscle stress, and participation in activities of daily living. Another irrefutable benefit of the SIT & STAND chair is that the chair eliminates the need for physical assistance from family members or health care personnel, preventing the development of disabling back injuries in personal care assistants. In addition, the SIT & STAND chair entirely removes the risk of pain or harm to the individual, which sometimes occurs with manual assist to stand, such as dislocation or fracture of frail shoulders with the under-axilla lift. Realizing the medical benefits of the SIT & STAND chair, Aetna completed a clinical policy bulletin that states that the seat lift mechanism is a medically necessary durable medical product. On the basis of this extensive product and performance evaluation, we recommend the SIT & STAND chair for the elderly as well as persons with disability to safely achieve a sit-to-stand position.     

Lymphocyte subpopulations infiltrating squamous carcinomas of the head and neck: correlations with extent of tumor and prognosis

Because little is known about the mechanisms involved in local tumor-host immune reactions in squamous carcinoma of the head and neck, a study was undertaken to better characterize the types of immune cells present at the local tumor site and determine their relationship to tumor extent, systemic cellular immune parameters, and clinical outcome. In 40 untreated patients, lymphocyte subsets (LS) at the tumor-host interface were quantitated immunohistologically from serial sections of frozen tumor specimens and correlated with concurrently measured peripheral LS levels and in vitro lymphocyte reactivity to phytohemagglutinin (PHA). The majority of infiltrating lymphocytes were T cells with rare B or Leu 7 cells. Proportions of T4 and T8 were similar in peritumor stroma; however, T8 cells predominated tumor parenchyma. Stromal and parenchymal infiltration by LS were not related to peripheral blood LS levels, lymphocyte reactivity, or tumor site. However, parenchymal T11 and T4 cell infiltration was less in advanced primary tumors (T3, T4) than in early tumors (T1, T2) (P = 0.01, P = 0.067, respectively), as was peripheral lymphocyte reactivity to PHA (P = 0.013). Short-term disease-free interval and actuarial survival differed significantly--according to parenchymal T11 and T4 cell infiltration--and were not related to T8, Leu 7, and B-cell infiltration. The findings extend prior studies of lymphocytic infiltration in head and neck cancer and demonstrate the potential importance of differences in tumor stromal and parenchymal infiltration. Together with recent evidence that T4 cells are critical for lymphokine production and for the proliferation of cytotoxic effector cells, the current results suggest that T4 cells play a critical role in the local immune response in squamous carcinoma of the head and neck.     

A tripartite cytolytic toxin formed by Vibrio cholerae proteins with flagellum-facilitated secretion

The protein MakA was discovered as a motility-associated secreted toxin from Vibrio cholerae. Here, we show that MakA is part of a gene cluster encoding four additional proteins: MakB, MakC, MakD, and MakE. MakA, MakB, and MakE were readily detected in culture supernatants of wild-type V. cholerae, whereas secretion was very much reduced from a flagellum-deficient mutant. Crystal structures of MakA, MakB, and MakE revealed a structural relationship to a superfamily of bacterial pore-forming toxins. Expression of MakA/B/E in Escherichia coli resulted in toxicity toward Caenorhabditis elegans used as a predatory model organism. None of these Mak proteins alone or in pairwise combinations were cytolytic, but an equimolar mixture of MakA, MakB, and MakE acted as a tripartite cytolytic toxin in vitro, causing lysis of erythrocytes and cytotoxicity on cultured human colon carcinoma cells. Formation of oligomeric complexes on liposomes was observed by electron microscopy. Oligomer interaction with membranes was initiated by MakA membrane binding followed by MakB and MakE joining the assembly of a pore structure. A predicted membrane insertion domain of MakA was shown by site-directed mutagenesis to be essential for toxicity toward C. elegans. Bioinformatic analyses revealed that the makCDBAE gene cluster is present as a genomic island in the vast majority of sequenced genomes of V. cholerae and the fish pathogen Vibrio anguillarum. We suggest that the hitherto-unrecognized cytolytic MakA/B/E toxin can contribute to Vibrionaceae fitness and virulence potential in different host environments and organisms.

Vibrio cholerae is known as the cause of cholera, a disease that can lead to fatal dehydration (1). The disease is caused by a few serogroups, and the main factor behind the symptoms is the cholera toxin (CT) encoded by genes located on a prophage mobile genetic element (CTX-φ) that induce severe disruption of intestinal cell function, leading to watery, secretory diarrhea (2). Most serogroups do not cause cholera, as they do not possess the genes for CT, but they cause other diseases [e.g., skin, wound, and gastrointestinal infections as well as bacteremia (3)]. The natural reservoirs of V. cholerae are aquatic sources such as rivers, brackish waters, and estuaries and are often associated with copepods, aquatic plants, and shellfish (4). The factors and mechanisms allowing V. cholerae and other Vibrionaceae to survive and thrive in harsh natural environments are of major interest to researchers (5).V. cholerae is motile by virtue of a single polar flagellum. The flagellum export machinery and the virulence-associated type-III secretion system (fT3SS and vT3SS, respectively) are suggested to share a common ancestor (6), explaining their similar structure and molecular organization. The vT3SS allows the delivery of effector proteins through a hollow channel directly to the eukaryotic host cell (7), and flagellar proteins are delivered via the fT3SS channel during flagellum assembly. In the bacterial cytoplasm, effectors secreted by the vT3SS are stabilized by chaperones to prevent aggregation. These chaperones are often encoded by genes adjacent to those encoding the effectors (8). Flagellar proteins are similarly protected by chaperones before they are transported to the growing distal end of the flagellum (9).We use Caenorhabditis elegans as a predatory organism model for identifying and assessing V. cholerae factors, other than CT, that may contribute to bacterial survival and persistence (10). With this model, we discovered a cytotoxin, MakA (motility-associated killing factor A), which we demonstrated to be an essential factor for the cytotoxic activity of V. cholerae in both C. elegans and Danio rerio (zebrafish) (11). We also demonstrated that secretion of MakA occurs via the flagellum in a manner that is undocumented in V. cholerae. Our crystal structure of MakA revealed similarities to ClyA (11), the pore-forming toxin first identified in nonpathogenic Escherichia coli (12, 13) and, subsequently, also in Salmonella enterica (14). ClyA from E. coli is expressed from a monocistronic operon and oligomerizes into a dodecameric pore upon release via membrane vesicles (13, 15, 16). MakA is also structurally related to two proteins from Bacillus cereus, the hemolysin BL binding component B (HBL-B) and the NheA component of the Nhe nonhemolytic enterotoxin. Both of these are considered components of tripartite toxins (17). Recently, a tripartite toxin, AhlABC, was identified and structurally characterized as a pore-forming toxin in Aeromonas hydrophila, and the structure of soluble AhlB shares the general structure described for MakA (18). A similar toxin complex of three proteins, SmhABC from Serratia marcescens, was also reported (19). However, if and how the Ahl and Smh proteins are released during normal growth, or if there is a dedicated secretion system, remain unclear.Here, we identify the proteins from the five V. cholerae genes, vca0880 through vca0884, that are coexpressed from the operon makDCBAE and analyze the crystal structures of MakA, MakB, and MakE. Our in vitro studies revealed that an equimolar combination of the MakA/B/E proteins acted as a tripartite cytotoxin causing lysis of red blood cells and cytotoxicity to epithelial cells. Examination of a large number of bacterial genomes revealed that the mak operon is present in many V. cholerae and other Vibrionaceae strains. These include Vibrio (Listonella) anguillarum, an inhabitant of estuarine and marine coastal ecosystems worldwide and the etiological agent of vibriosis in warm- and cold-water fish (20). The identification and structural characterization of the Mak proteins in V. cholerae presented here reveals a hitherto-unrecognized potential of many pathogenic Vibrionaceae strains to produce the tripartite Mak cytolytic toxin.     

A human-mouse chimera of the alpha3alpha4alpha5(IV) collagen protomer rescues the renal phenotype in Col4a3-/- Alport mice

Collagen IV is a major structural component of basement membranes. In the glomerular basement membrane (GBM) of the kidney, the alpha3, alpha4, and alpha5(IV) collagen chains form a distinct network that is essential for the long-term stability of the glomerular filtration barrier, and is absent in most patients affected with Alport syndrome, a progressive inherited nephropathy associated with mutation in COL4A3, COL4A4, or COL4A5 genes. To investigate, in vivo, the regulation of the expression, assembly, and function of the alpha3alpha4alpha5(IV) protomer, we have generated a yeast artificial chromosome transgenic line of mice carrying the human COL4A3-COL4A4 locus. Transgenic mice expressed the human alpha3 and alpha4(IV) chains in a tissue-specific manner. In the kidney, when expressed onto a Col4a3(-/-) background, the human alpha3(IV) chain restored the expression of and co-assembled with the mouse alpha4 and alpha5(IV) chains specifically at sites where the human alpha3(IV) was expressed, demonstrating that the expression of all three chains is required for network assembly. The co-assembly of the human and mouse chains into a hybrid network in the GBM restores a functional GBM and rescues the Alport phenotype, providing further evidence that defective assembly of the alpha3-alpha4-alpha5(IV) protomer, caused by mutations in any of the three chains, is the pathogenic mechanism responsible for the disease. This line of mice, humanized for the alpha3(IV) collagen chain, will also provide a valuable model for studying the pathogenesis of Goodpasture syndrome, an autoimmune disease caused by antibodies against this chain.     

Poly(ADP-ribose) polymerase at active centromeres and neocentromeres at metaphase

A double-stranded 9 bp GTGAAAAAG pJ alpha sequence found in human centromeric alpha-satellite DNA and a 28 bp ATGTATATATGTGTATATAGACATAAAT tandemly repeated AT28 sequence found within a cloned neo- centromere DNA have each allowed the affinity purification of a nuclear protein that we have identified as poly(ADP-ribose) polymerase (PARP). Use of other related or unrelated oligonucleotide sequences as affinity substrates has indicated either significantly reduced or no detectable PARP purification, suggesting preferential but not absolute sequence-specific binding. Immunofluorescence analysis of human and sheep metaphase cells using a polyclonal anti-PARP antibody revealed centromeric localization of PARP, with diffuse signals also seen on the chromosome arms. Similar results were observed for mouse chromosomes except for a significantly enlarged PARP-binding region around the core centromere-active domain, suggesting possible 'spreading' of PARP into surrounding non-core centromeric domains. Enhanced PARP signals were also observed on alpha-satellite-negative human neo- centromeres and on the active but not the inactive alpha-satellite-containing centromere of a human dicentric chromosome. PARP signals were absent from the q12 heterochromatin of the Y chromosome, suggesting a correlation of PARP binding with centromere function that is independent of heterochromatic properties. Preliminary cell cycle analysis indicates detectable centromeric association of PARP during S/G(2)phase and that the total proportion of PARP that is centromeric is relatively low. Strong binding of PARP to different centromere sequence motifs may offer a versatile mechanism of mammalian centromere recognition that is independent of primary DNA sequences.     

Induction of colony-stimulating factor expression following Staphylococcus or Salmonella interaction with mouse or human osteoblasts

Staphylococcus aureus and Salmonella spp. are common causes of bone diseases; however, the immune response during such infections is not well understood. Colony-stimulating factors (CSF) have a profound influence on osteoclastogenesis, as well as the development of immune responses following infection. Therefore, we questioned whether interaction of osteoblasts with two very different bacterial pathogens could affect CSF expression by these cells. Cultured mouse and human osteoblasts were exposed to various numbers of S. aureus or Salmonella dublin bacteria, and a comprehensive analysis of granulocyte-macrophage (GM)-CSF, granulocyte (G)-CSF, macrophage (M)-CSF, and interleukin-3 (IL-3) mRNA expression and cytokine secretion was performed. Expression of M-CSF and IL-3 mRNAs by mouse osteoblasts was constitutive and did not increase significantly following bacterial exposure. In contrast, GM-CSF and G-CSF mRNA expression by mouse osteoblasts was dramatically upregulated following interaction with either viable S. aureus or Salmonella. This increased mRNA expression also translated into high levels of GM-CSF and G-CSF secretion by mouse and human osteoblasts following bacterial exposure. Viable S. aureus and Salmonella induced maximal levels of CSF mRNA expression and cytokine secretion compared to UV-killed bacteria. Furthermore, GM-CSF and G-CSF mRNA expression could be induced in unexposed osteoblasts separated by a permeable Transwell membrane from bacterially exposed osteoblasts. M-CSF secretion was increased in cultures of exposed human osteoblasts but not in exposed mouse osteoblast cultures. Together, these studies are the first to define CSF expression and suggest that, following bacterial exposure, osteoblasts may influence osteoclastogenesis, as well as the development of an immune response, via the production of these cytokines.