Prostaglandin E1 and dibutyryl cyclic AMP enhance platelet resistance to deformation

The effect of prostaglandin E₁ (PGE₁) on platelets is mediated through the PGE₁ receptor and the consequent maintenance of the platelet's discoid shape. The effects of PGE₁ and dibutyryl cAMP (dbcAMP) on the deformability of human platelets were studied. Deformability tests based upon the micropipette aspiration on the platelets were performed by using pipettes with radii (Rp) of 0.26-0.36 gm. The time course of the extension length (Dp, in μg) of the platelets in response to aspiration with a negative pressure (ΔP) of 5 cm H₂ O (ΔP × Rp = 0.15 dynes/cm) was analyzed. PGE₁ treatment (0.1 μM) resulted in a decrease of platelet deformability as compared with results obtained for apparently non-activated, control platelets. The deformation index, i.e., Dp/Rp (PGE₁ -treated) / Dp/Rp (control), was significantly reduced to 0.90 ± 0.04. DbcAMP treatment also significantly decreased the deformability of platelets and this decrease was dbcAMP dose dependent. In contrast, colchicine- or cytochalasin D-treated platelets increased deformability. PGE₁ -treated platelets had a higher [cAMP]_i than controls. Platelets treated with PGE₁ or dbcAMP showed a reduced [Ca²⁺]i increment induced by thrombin as compared to non-treated controls. These results indicate that PGE₁ and dbcAMP treatment of platelets is accompanied by an enhancement of platelet resistance to deformation. The increased [cAMP]_i and low [Ca²⁺]_i after PGE₁ treatment may limit the rearrangement of cytoskeleton and thus enhance platelet resistance to deformation.     

Drug mixture which improves survival of ischemic rabbit epigastric skin flaps

The chief aim of this study was to maximize flap survival by counteracting the pathophysiological changes occurring during ischemia-reperfusion. Rabbit epigastric skin flaps given 21 hours of ischemia were infused intra-arterially with selected drugs at the start of reperfusion. Compared with control infused ischemic flaps, which had a 33% survival rate on day 7 post-ischemia, significant improvement was found with vasodilators nitrendipine (61%) and prostacyclin (65%) and the thrombolytic agent urokinase (65%); marginal improvement with the free radical scavenger desferrioxamine (53%); but no change with streptokinase (44%), heparin (21%), and ATP-MgCl₂ (35%). A drug mixture comprising all of these agents except streptokinase and urokinase produced 87% survival, suggesting an additive effect. Biochemical assays on skin homogenates and blood implicated oxygen free radicals, neutrophil infiltration, and thromboxane in flap failure. These results imply that multiple factors are responsible for ischemic flap failure and that a mixture of drugs needs to be infused to counteract all of the detrimental changes. © 1994 Wiley-Liss, Inc.     

Bowel visualization during indium-111-labelled diethylene triamine penta-acetic acid cisternography due to massive cerebrospinal fluid leak

We report a case of massive cerebrospinal fluid (CSF) leakage where the tracer injected intra-thecally for radionuclide cisternography was later visualized in the bowel as well as the nasopharynx. We discuss the potential implications of this finding in patients with CSF leaks. A brief review of the diagnosis of CSF leaks is included.     

Hormone replacement therapy is associated with increased C-reactive protein in women with Type 2 diabetes in the Diabetes Heart Study.

AIMS: Increased levels of inflammatory biomarkers, especially C-reactive protein (CRP), are associated with increased risk for cardiovascular disease (CVD) events, such as myocardial infarction, stroke, peripheral vascular disease, and sudden cardiac death. Medical interventions that increase CRP levels, such as hormone replacement therapy (HRT) in post-menopausal women, are under increasing scrutiny. The effect of HRT on CRP levels in women with Type 2 diabetes (T2DM) is not well documented, and conflicting conclusions have been reported. The aim of this study was to determine the influence of HRT on women with diabetes in a large cross-sectional study. METHODS: Three hundred and twenty-seven post-menopausal women with T2DM from the Diabetes Heart Study participated. Current use of HRT was determined and serum CRP levels were measured using a high-sensitivity ELISA kit. Generalized estimating equation methods were used to assess the relationship of multiple clinical and lifestyle (e.g. smoking) measures on CRP levels including differences between women taking HRT (HRT+) and not taking HRT (HRT-). RESULTS: Overall serum CRP levels were strongly associated with body mass index (P < 0.0001) and age (P < 0.0001). Of the women, 243 were not using HRT and 84 were using HRT. HRT+ and HRT- women did not differ significantly in measures of clinical traits, with the exception of higher mean low-density lipoprotein cholesterol in HRT- women (P = 0.004). In all models tested, HRT+ women had significantly higher circulating CRP levels, with P-values ranging from 0.0045 to 0.010. CONCLUSIONS: In this study of serum CRP concentration as a function of HRT in women with Type 2 diabetes, there was consistent evidence for increased circulating CRP levels in women receiving oestrogen-containing HRT. Whether HRT-induced increases in CRP can account for the adverse cardiovascular effects of HRT remains to be established; however, based on these data, there is little reason to believe that diabetic women would be spared from such an effect.     

Nucleotide changes around the splicing acceptor of intron 24 in the factor VIII gene and its impact on splicing.

Nucleotide 6724 of the factor VIII gene harbors a polymorphism of low frequency. A report from Taiwan claimed that 97.9% of the 83 alleles examined were of the A nucleotide at this position, which is quite different to the data from Western populations. Furthermore, this nucleotide is the start of exon 25, located in juxtaposition to the splicing acceptor of intron 24. We wonder if the nucleotide change at this location might have any effect on the splicing process of pre-mRNA. Using genomic DNA with direct sequencing of the polymerase chain reaction-amplified intron 24/exon 25 junction site, we found that 59 of the 60 patient samples were of the GTG sequence at nucleotides 6724-6726. The polymorphism is similar between populations in Taiwan and Western countries. The sequence of intron 24 around the splicing acceptor was always TCCAACTCTATTGCCCTCAG (-20 to -1), except for one hemophiliac patient who had a mutation in which the absolute consensus AG doublet of the intron 24 splicing acceptor changed to the AA dinucleotide. Owing to the mutation, exon 24 was erroneously spliced to exon 26, and exon 25 was skipped. This finding further testifies to the importance of the invariant AG dinucleotide in the example of the factor VIII gene.     

Sonography of a human jackstone calculus.

Jackstone calculi are urinary tract stones that have a specific appearance resembling toy jacks. They are almost always composed of calcium oxalate dihydrate and may be found in the urinary bladder or rarely in the upper urinary tract. Their appearance on plain radiographs and computed tomography (CT) in human patients has been well described. They have also been imaged in several species of animals. However, our review of the English medical literature revealed no previous report in which a jackstone calculus had been identified on the sonographic examination of a human patient. We report a case in which a large jackstone calculus was incidentally detected during abdominal sonography in a 75-year-old man.     

Immunohistochemical study of lymph nodes in patients with cat scratch disease.

BACKGROUND/PURPOSE: Bartonella henselaeis the causative agent of cat scratch disease (CSD), manifesting as fever and acute regional lymphadenopathy. Although serologic testing is the reference method for diagnosis, successful use of immunohistochemical (IHC) stain of regional lymph nodes for the diagnosis of CSD has been reported. To determine the characterization and diagnostic potential of IHC in lymphadenopathy of CSD, lymph nodes were excised from patients with suspected CSD for further evaluation. METHODS: Polyclonal antibody-based IHC studies were performed for the detection of B. henselae. Between January 2001 and December 2004, the reference laboratory of the Center for Disease Control, Taiwan, received a total of 377 sera from 352 reported suspected CSD cases. Twenty-three formalin-fixed paraffin-embedded lymph nodes from 16 patients and two skin biopsies from two patients suspected of having CSD were included in this study. Nine of them were serologically confirmed to have CSD and the others were seronegative but suspected to have CSD by the attending physicians. Seven lymph node specimens were obtained from tuberculosis patients for comparison. RESULTS: We demonstrated that the microorganisms existed in the cytoplasm of histiocytes within the granulomatous lesions in nine lymph nodes and one skin biopsy. Among the nine lymph nodes with IHC (+) stains, three were seronegative. On the other hand, three cases were IHC (+) and six cases were IHC (-) among nine seronegative patients. In addition, two seronegative patients with skin biopsy showed one IHC (+) and one IHC (-). CONCLUSION: IHC can contribute to the etiologic diagnosis of B. henselaelymphadenopathy when serology and molecular techniques are not available.