Mechanism of the chromosomal translocation t(14;18) in lymphoma: detection of a 45-Kd breakpoint binding protein

The translocation t(14;18) between the BCL-2 oncogene and the Ig heavy chain (IgH) gene provides the molecular basis for the development of follicular lymphomas. The illegitimate recombination occurs in early B cells. While V(D)J-recombinase is most likely involved on the chromosome 14 part, little is known about the mechanism of breakage on chromosome 18. We investigated the BCL-2 breakpoint regions for their structural vulnerability and protein binding capacity. We found that the major breakpoint region (mbr) contains an S1 nuclease-sensitive site and is the target of an endogenous nuclease present in early B cells. A 45 Kd nuclear protein (bp45) from early B cell extracts binds to a homopurine-homopyrimidine stretch (GGGAGGACGGGAGGAAGGCG) in the mbr, which is homologous to a recombinatorial element in Escherichia coli (CHI). The protein also binds to homologous sequences in the minor breakpoint cluster region (mcr) and in the IgH locus. The localization of the binding sites on both chromosomes as well as the tissue distribution of bp45 suggest that this protein-DNA interaction is involved in the translocation t(14;18). The DNA binding motif is also present at other translocation breakpoints indicating a more general role for this mechanism.     

Characterization of TEK receptor tyrosine kinase and its ligands, Angiopoietins, in human hematopoietic progenitor cells

TEK, or TIE-2, is a receptor tyrosine kinase (RTK) that is known as a functioning molecule of vascular endothelial cells. TEK comprises a subfamily of RTK with TIE, and these two receptors play critical roles in vascular maturation, maintenance of integrity and remodeling. We generated mAb against the extracellular domain of human TEK protein to elucidate its expression pattern in human hematopoietic cells. Flow cytometric analysis of bone marrow cells revealed that TEK was expressed in 27% of CD34+ cells, 20% of c-KIT+ cells and 26% of CD34+CD38- cells, indicating that TEK is expressed in a subset of primitive hematopoietic stem cells (HSC). TEK was also expressed in 20% of CD19+ B lymphocytes but not in other lineage-committed cells. Progenitor assays in methylcellulose culture showed that CD34+TEK+ cells formed significantly less BFU-E and CFU-Mix than CD34+TEK- cells, but there was no difference in the number of CFU-GM between these two populations. Two recently identified TEK ligands, termed Angiopoietin-1 and -2, bound to TEK with similar affinities, and Angiopoietin-1 effectively induced TEK phosphorylation in hematopoietic cells. Angiopoietin-2 also induced a low level of TEK phosphorylation and weakened the phosphorylation induced by Angiopoietin-1, suggestive of an elaborate regulator of the TEK-TEK ligand signaling pathway. Although neither ligands affected the proliferation of TEK-transfected hematopoietic cells or the colony formation of CD34+TEK+ bone marrow cells, both promoted the adhesion of TEK-transfected hematopoietic cells to a collagen matrix or a layer of bone marrow stromal cells. These findings indicate that the TEK-TEK ligand signaling pathway is regulated in a refined manner and is involved in hematopoietic cell- microenvironment interaction.