Benign osteoblastoma of the occipital bone: Case report and literature review

We present a case of benign osteoblastoma of the occipital bone. Benign osteoblastoma is an uncommon primary bone tumor, which usually involves the vertebrae and the long bones. This tumor rarely develops in the calvaria, showing a preference for the temporal and frontal bones when it does. To the best of our knowledge, this case is only the eighth reported case of benign osteoblastoma confined to the occipital bone. A 20‐year‐old male presented with a mild tender mass lesion of the occipital area, just below the lambda. Plain X‐ray films and CT scans demonstrated an osteolytic mass surrounded by the sclerotic rim within the diploic space. MRI proved to be effective for the evaluation of the intracranial and intraosseous extensions of the tumor. However, it was very difficult to formulate a differential diagnosis against other osteoblastic tumors, or osteoid osteoma, in view of its radiological appearance. The final diagnosis was obtained by careful consideration of the histopathological characteristics of the tumor combined with its clinical and radiological features. Although generally regarded as benign, a complete resection is preferred over conventional curettage as this can guard against possible recurrence and malignant transformation.     

Retrospective analysis of 5037 patients with nasopharyngeal carcinoma treated during 1976-1985: overall survival and patterns of failure.

This is a retrospective analysis of 5037 patients with squamous cell carcinoma of the nasopharynx treated during the years 1976-1985. The stage distribution according to Ho's classification was 9% Stage I, 13% II, 50% III, 22% IV, and 6% Stage V. Only 4488 (89%) patients had a full course of megavoltage radiation therapy. The median equivalent dose to the nasopharyngeal region was 65 Gy and cervical region in node-positive patients 53 Gy. Seventy percent (906/1290) of the node-negative patients had no prophylactic neck irradiation. The overall actuarial 10-year survival rate was 43%, and the corresponding failure-free survival 34%. Altogether, 4157 (83%) patients achieved complete remission lasting more than 6 months, but 53% (2205/4157) of them relapsed after a median interval of 1.4 years. The 10-year actuarial local, regional, and distant failure-free rates were 61%, 64%, and 59%, respectively. Thirty-eight percent (338/891) of all patients with local recurrence achieved second local remission. The local complete remission rate with aggressive re-irradiation alone was 47% (333/706). But 37% (124/338) of the responders recurred the second time. The incidence of distant failure correlated significantly with both the N-stage and the T-stage, with the highest (57%) occurring in patients with N3 disease. The incidence of nodal relapse in node-negative patients was 11% (44/384) among those given prophylactic neck irradiation, but 40% (362/906) among those without. Therapeutic irradiation achieved a complete regional remission rate of 90% (306/339). However, despite successful salvage, these patients had a significantly higher distant failure rate than those without nodal relapse, even if they remained local-failure-free (21% vs 6%). Patients treated during 1981-1985 achieved significantly better treatment results than those treated during 1976-1980, especially in terms of the overall survival (57% vs 47% at 5-year), the overall failure-free survival (42% vs 35% at 5-year), and the local failure-free rate (70% vs 63% at 5-year). The possible contributing factors are discussed.     

Metabolic consequences of hypercapnia in the rainbow trout, Salmo gairdneri: beta-adrenergic effects

The metabolic consequences of external hypercapnia (1% CO2) were assessed in rainbow trout (Salmo gairdneri) in the presence or absence of circulating levels of the beta adrenoceptor antagonist, propranolol. External hypercapnia caused a severe extracellular respiratory acidosis and a less pronounced reduction of hepatic intracellular pH (pHi). pHi was restored to prehypercapnic values after 48 hr of continuous hypercapnia due to elevation of bicarbonate levels. In the presence of propranolol, hypercapnia elicited a pronounced activation of pyruvate kinase (PyK) (measured at both low and high phosphoenolpyruvate (PEP) concentrations) and inactivation of both total glycogen phosphorylase (GPase) and glycogen phosphorylase a (GPase a). In the absence of propranolol, the changes in enzyme activities were significantly reduced (low PEP PyK activity) or totally absent (GPase inactivation). These results suggest that beta adrenoceptor-mediated phenomena offset disruptive effects of hypercapnia on PyK and GPase activities and may be important in the control of gluconeogenesis and glycogenolysis during this acid-base disturbance. The adrenergic effects were not related to modification of hepatic intracellular acid-base status. Hypercapnia induced a rapid depletion of liver glycogen and concomitant hyperglycemia. These effects were not prevented by pretreating fish with propranolol and appeared to be unrelated to changes in GPase a activity. These results suggest that factors other than adrenergic activation of GPase a are involved in the enhancement of liver glycogenolysis.     

The effect of combinations of ampligen and zidovudine or dideoxyinosine against human immunodeficiency viruses in vitro.

The combinations of ampligen and zidovudine at ratios of 100:1, 25:1, 10:1, and 1:50 acted synergistically to reduce cytopathology caused by HIV in MT-2 cell cultures. Combination indices were less than 1 at all of these ratios representing different combinations of concentrations and at 3 effective doses (ED30, ED50, ED70). Combination of drugs which show synergism at a wide range of ratios of combinations suggest that they may be useful clinically, and that the antiviral efficacy of ZDV may be increased in combination with ampligen. Synergism was also found between ampligen and zidovudine by reduction of HIV-produced plaques in a HeLa cell line expressing CD-4 receptors. However the combination of ampligen and dideoxyinosine against HIV in MT-2 cells was only additive and not synergistic.     

Polymorphisms in manganese superoxide dismutase and catalase genes: functional study in Hong Kong Chinese asthma patients

BACKGROUND: Reactive oxygen species may contribute to the pathogenesis of asthma. Functional genetic polymorphisms of antioxidant enzymes, superoxide dismutase (SOD) and catalase are good candidates for asthma susceptibility. OBJECTIVE: To investigate the association of the manganese-containing form of SOD (MnSOD) gene at amino acid position 16 (Val16Ala) and catalase gene in the promoter at A-21T and C-262T polymorphisms and asthma in a Hong Kong Chinese population. METHODS: The association study was conducted in a case-control design in asthma patients (n=251) and healthy controls (n=316) by genotyping. The functional significance was assessed by determining erythrocyte SOD and catalase activity. RESULTS: The Val allele of MnSOD at Val16Ala and the A allele of catalase gene at A-21T were not different between patients and controls, while the C allele of catalase gene at C-262T was found to be significantly different between patients and controls (P=0.033). The less frequent variant of catalase gene (-262T) was found to be protective from the development of asthma in a Hong Kong Chinese non-smoking population (adjusted odds ratio=0.35, 0.15-0.85; P=0.017). Asthma patients had elevated erythrocyte SOD and catalase activities in comparison with healthy controls (P<0.01). However, their activities were not associated with different genotypes within healthy controls or asthma patients. CONCLUSION: This is the first report showing that SOD and catalase functional activities are not associated with their respective genetic polymorphisms but related to the presence of asthma in a Hong Kong Chinese population.     

The small ptotic breast: reposition autoaugmentation mammaplasty

Autoaugmentation mammaplasty of the small ptotic breast with adjacent pedicled fat and simultaneous correction of ptosis is presented. The operative procedure is described and some representative results are shown.     

Nucleotide changes around the splicing acceptor of intron 24 in the factor VIII gene and its impact on splicing.

Nucleotide 6724 of the factor VIII gene harbors a polymorphism of low frequency. A report from Taiwan claimed that 97.9% of the 83 alleles examined were of the A nucleotide at this position, which is quite different to the data from Western populations. Furthermore, this nucleotide is the start of exon 25, located in juxtaposition to the splicing acceptor of intron 24. We wonder if the nucleotide change at this location might have any effect on the splicing process of pre-mRNA. Using genomic DNA with direct sequencing of the polymerase chain reaction-amplified intron 24/exon 25 junction site, we found that 59 of the 60 patient samples were of the GTG sequence at nucleotides 6724-6726. The polymorphism is similar between populations in Taiwan and Western countries. The sequence of intron 24 around the splicing acceptor was always TCCAACTCTATTGCCCTCAG (-20 to -1), except for one hemophiliac patient who had a mutation in which the absolute consensus AG doublet of the intron 24 splicing acceptor changed to the AA dinucleotide. Owing to the mutation, exon 24 was erroneously spliced to exon 26, and exon 25 was skipped. This finding further testifies to the importance of the invariant AG dinucleotide in the example of the factor VIII gene.     

Tests for latent tuberculosis

Sir, In their article, Shankar and colleagues underline the significantburden of tuberculosis within their population and the importanceof identifying latent infection