Prostaglandin E1 and dibutyryl cyclic AMP enhance platelet resistance to deformation

The effect of prostaglandin E₁ (PGE₁) on platelets is mediated through the PGE₁ receptor and the consequent maintenance of the platelet's discoid shape. The effects of PGE₁ and dibutyryl cAMP (dbcAMP) on the deformability of human platelets were studied. Deformability tests based upon the micropipette aspiration on the platelets were performed by using pipettes with radii (Rp) of 0.26-0.36 gm. The time course of the extension length (Dp, in μg) of the platelets in response to aspiration with a negative pressure (ΔP) of 5 cm H₂ O (ΔP × Rp = 0.15 dynes/cm) was analyzed. PGE₁ treatment (0.1 μM) resulted in a decrease of platelet deformability as compared with results obtained for apparently non-activated, control platelets. The deformation index, i.e., Dp/Rp (PGE₁ -treated) / Dp/Rp (control), was significantly reduced to 0.90 ± 0.04. DbcAMP treatment also significantly decreased the deformability of platelets and this decrease was dbcAMP dose dependent. In contrast, colchicine- or cytochalasin D-treated platelets increased deformability. PGE₁ -treated platelets had a higher [cAMP]_i than controls. Platelets treated with PGE₁ or dbcAMP showed a reduced [Ca²⁺]i increment induced by thrombin as compared to non-treated controls. These results indicate that PGE₁ and dbcAMP treatment of platelets is accompanied by an enhancement of platelet resistance to deformation. The increased [cAMP]_i and low [Ca²⁺]_i after PGE₁ treatment may limit the rearrangement of cytoskeleton and thus enhance platelet resistance to deformation.     

An Unusual Form of Skin Tuberculosis Following B.C.G. Vaccination

A 25-year-old female has had brown to erythematous telangiectatic patches and grouped papules on her face, neck, arm, and trunk since childhood following B.C.G. vaccination. Histopathologically, the lesions consisted of hyperkeratosis, slight acanthosis, tuberculoid granulomas with some Langerhans type giant cells in the mid-dermis. Although various forms of cutaneous tuberculosis after B.C.G. vaccination have been reported, it was difficult for us to assign the patient's skin lesion to any specific disease entity. Remission of her cutaneous lesions occurred clinically and histopathologically after treatment with isoniazid and rifampin.     

Self‐reflection and self‐practice in training of Cognitive Behaviour Therapy: an overview

The present paper deals with a developing training element in cognitive behaviour therapy (CBT), the self‐practice of therapeutic techniques and the self‐exploration of the person of the therapist. Initially, the current status of this training element in CBT is discussed, and a short note on its terminology is presented. Then an overview of the most important objectives of self‐practice and self‐reflection in CBT, and the concepts and methods of practice of this element is given. The concepts focus on two major aims, the self‐exploration of the person of the therapist within and beyond his or her therapeutic practice, and the self‐application of therapeutic techniques (= self‐practice). In the second part of the paper empirical studies related to the outcome of self‐reflection and self‐practice on the development of the therapist and her or his therapeutic practice are reviewed. The few empirical studies show that trainees experience in their own view substantial professional and personal gains from this training tool, with the professional impact being more important than the personal one. The most important outcomes evaluated by subjective data from the trainees are improvements in self‐insight and self‐awareness and a better understanding of the therapist's role and the therapeutic change process. Additionally, a better understanding of CBT methods and of general therapeutic skills, such as empathy and role‐taking‐competencies, are reported by the trainees. The paper comes to the conclusion that self‐exploration and self‐practice are important components of CBT training. Consequences and recommendations for its integration into training courses for CBT are discussed as well as the necessity for more research in this area. Copyright © 2002 John Wiley & Sons, Ltd.     

Hormone replacement therapy is associated with increased C-reactive protein in women with Type 2 diabetes in the Diabetes Heart Study.

AIMS: Increased levels of inflammatory biomarkers, especially C-reactive protein (CRP), are associated with increased risk for cardiovascular disease (CVD) events, such as myocardial infarction, stroke, peripheral vascular disease, and sudden cardiac death. Medical interventions that increase CRP levels, such as hormone replacement therapy (HRT) in post-menopausal women, are under increasing scrutiny. The effect of HRT on CRP levels in women with Type 2 diabetes (T2DM) is not well documented, and conflicting conclusions have been reported. The aim of this study was to determine the influence of HRT on women with diabetes in a large cross-sectional study. METHODS: Three hundred and twenty-seven post-menopausal women with T2DM from the Diabetes Heart Study participated. Current use of HRT was determined and serum CRP levels were measured using a high-sensitivity ELISA kit. Generalized estimating equation methods were used to assess the relationship of multiple clinical and lifestyle (e.g. smoking) measures on CRP levels including differences between women taking HRT (HRT+) and not taking HRT (HRT-). RESULTS: Overall serum CRP levels were strongly associated with body mass index (P < 0.0001) and age (P < 0.0001). Of the women, 243 were not using HRT and 84 were using HRT. HRT+ and HRT- women did not differ significantly in measures of clinical traits, with the exception of higher mean low-density lipoprotein cholesterol in HRT- women (P = 0.004). In all models tested, HRT+ women had significantly higher circulating CRP levels, with P-values ranging from 0.0045 to 0.010. CONCLUSIONS: In this study of serum CRP concentration as a function of HRT in women with Type 2 diabetes, there was consistent evidence for increased circulating CRP levels in women receiving oestrogen-containing HRT. Whether HRT-induced increases in CRP can account for the adverse cardiovascular effects of HRT remains to be established; however, based on these data, there is little reason to believe that diabetic women would be spared from such an effect.     

Nucleotide changes around the splicing acceptor of intron 24 in the factor VIII gene and its impact on splicing.

Nucleotide 6724 of the factor VIII gene harbors a polymorphism of low frequency. A report from Taiwan claimed that 97.9% of the 83 alleles examined were of the A nucleotide at this position, which is quite different to the data from Western populations. Furthermore, this nucleotide is the start of exon 25, located in juxtaposition to the splicing acceptor of intron 24. We wonder if the nucleotide change at this location might have any effect on the splicing process of pre-mRNA. Using genomic DNA with direct sequencing of the polymerase chain reaction-amplified intron 24/exon 25 junction site, we found that 59 of the 60 patient samples were of the GTG sequence at nucleotides 6724-6726. The polymorphism is similar between populations in Taiwan and Western countries. The sequence of intron 24 around the splicing acceptor was always TCCAACTCTATTGCCCTCAG (-20 to -1), except for one hemophiliac patient who had a mutation in which the absolute consensus AG doublet of the intron 24 splicing acceptor changed to the AA dinucleotide. Owing to the mutation, exon 24 was erroneously spliced to exon 26, and exon 25 was skipped. This finding further testifies to the importance of the invariant AG dinucleotide in the example of the factor VIII gene.     

Sonography of a human jackstone calculus.

Jackstone calculi are urinary tract stones that have a specific appearance resembling toy jacks. They are almost always composed of calcium oxalate dihydrate and may be found in the urinary bladder or rarely in the upper urinary tract. Their appearance on plain radiographs and computed tomography (CT) in human patients has been well described. They have also been imaged in several species of animals. However, our review of the English medical literature revealed no previous report in which a jackstone calculus had been identified on the sonographic examination of a human patient. We report a case in which a large jackstone calculus was incidentally detected during abdominal sonography in a 75-year-old man.     

INVASIVE MUCORMYCOSIS WITH GASTRIC INVOLVEMENT IN A PATIENT WITH SEVERE ATHEROMATOUS VASCULAR DISEASE

Gastric mucormycosis involvement is a rare condition that usually occurs in inmunocompromised patients and frequently has a fatal outcome. We report the case of a 73‐year‐old woman admitted to the intensive care unit with severe bleeding after an acute pulmonary disease. Upper endoscopy disclosed wide and deep necrotic ulcers in the body and fundus of the stomach and greenish exudates with the antrum and the duodenum undamaged. Autopsy revealed an invasive mucormycosis and a severe atheromatosis. Several predisposing factors for mucormycosis infection have been reported until now. We postulate that ischemic gastritis could be a predisposing factor for colonization of zygomycete.     

Immunohistochemical study of lymph nodes in patients with cat scratch disease.

BACKGROUND/PURPOSE: Bartonella henselaeis the causative agent of cat scratch disease (CSD), manifesting as fever and acute regional lymphadenopathy. Although serologic testing is the reference method for diagnosis, successful use of immunohistochemical (IHC) stain of regional lymph nodes for the diagnosis of CSD has been reported. To determine the characterization and diagnostic potential of IHC in lymphadenopathy of CSD, lymph nodes were excised from patients with suspected CSD for further evaluation. METHODS: Polyclonal antibody-based IHC studies were performed for the detection of B. henselae. Between January 2001 and December 2004, the reference laboratory of the Center for Disease Control, Taiwan, received a total of 377 sera from 352 reported suspected CSD cases. Twenty-three formalin-fixed paraffin-embedded lymph nodes from 16 patients and two skin biopsies from two patients suspected of having CSD were included in this study. Nine of them were serologically confirmed to have CSD and the others were seronegative but suspected to have CSD by the attending physicians. Seven lymph node specimens were obtained from tuberculosis patients for comparison. RESULTS: We demonstrated that the microorganisms existed in the cytoplasm of histiocytes within the granulomatous lesions in nine lymph nodes and one skin biopsy. Among the nine lymph nodes with IHC (+) stains, three were seronegative. On the other hand, three cases were IHC (+) and six cases were IHC (-) among nine seronegative patients. In addition, two seronegative patients with skin biopsy showed one IHC (+) and one IHC (-). CONCLUSION: IHC can contribute to the etiologic diagnosis of B. henselaelymphadenopathy when serology and molecular techniques are not available.     

Relationship between Mandarin speech reception thresholds and pure-tone thresholds in the geriatric population.

BACKGROUND/PURPOSE: In the geriatric population, the reliability of pure-tone threshold (PTT) is sometimes poorer than that in young adults because of various reasons. This study assessed the relationship between Mandarin speech reception thresholds (SRTs) and PTTs in the aged and developed SRT as a measure for corroborating PTT. METHODS: This prospective study enrolled 46 consecutive subjects over 60 years of age. The results of SRT and PTT were collected from one ear randomly selected from each subject. Simple linear and multiple regressions were used to determine the correlation and linear regression coefficients between SRTs and PTTs at various frequencies. RESULTS: In the simple regression analysis, the correlation coefficient was highest at 1000 Hz (r = 0.949) and 500 Hz (r = 0.922), followed by 250 Hz (r = 0.850) and 2000 Hz (r = 0.792). In the multiple regression model with SRT as the dependent variable and PTTs as predictor variables, the resultant multiple correlation coefficient R was 0.967, while R2 was 0.936. In this model, PTTs at the frequencies of 500 Hz and 1000 Hz contributed significantly to the variance in SRTs with p values of 0.029 and < 0.001, respectively. These results demonstrated that the Mandarin SRT is strongly associated with PTTs at the frequencies of 500 Hz and 1000 Hz. CONCLUSION: This study established the agreement between Mandarin SRTs and PTTs in the low tone area of speech frequencies in the geriatric population. In clinical settings, SRT test can be rapidly and easily performed and is relatively inexpensive. It is a vital indicator of the accuracy of PTT measurement.