Effect of normal mosquito extracts upon arbovirus recoveries from mosquito pools

Titers of Turlock (TUR) and Hart Park (HP) viruses were reduced to undetectable levels when virus was mixed with a triturated suspension of uninfected (normal) 4th instar larvae of Culex tarsalis prior to plaque assay in cell culture. There was a linear relationship between the number of larvae in the pool and the titer of virus recoverable. Virus was undetectable when 1,000-10,000 PFU of either agent was added to pools that contained 25 or more larvae. Suspensions of up to 25 adult male or female Cx. tarsalis had little effect on detectable viral titers while pupal suspensions had an intermediate effect. The inhibitory effect of normal larval extracts on viral infectivity could be counteracted by use of polycations or a high pH buffer. A similar reduction in titer of TUR virus was observed with extracts of larvae of Aedes melanimon or Anopheles franciscanus. Larval extracts of Cx. tarsalis similarly reduced titers of California and St. Louis encephalitis viruses but not western equine encephalomyelitis virus. These findings may have significant bearing on the interpretation of transovarial transmission attempts in which pooled larvae are assayed for virus.     

Acromegaly: biochemical assessment of cure after long term follow-up of transsphenoidal selective adenomectomy

This study reports the clinical and biological follow-up 5-11 yr after transsphenoidal selective adenomectomy in 25 patients with acromegaly. Eight patients had microadenomas, and 17 had macroadenomas. Initial normalization of plasma GH levels (basal values, less than 5 ng/ml; glucose-suppressed concentrations, less than 2.5 ng/ml) was achieved in all 8 patients with microadenomas and in 13 patients with macroadenomas. Of these, 3 patients with normal GH levels and dynamics had relapse of GH hypersecretion after intervals between 1-6 yr after microadenoma removal. Recurrence of pituitary adenoma was documented by surgery in 1 patient and by computed tomographic scanning in 2 others. Normal basal and glucose-suppressed plasma GH concentrations were maintained 7.4 +/- 0.5 (+/- SEM) yr after adenomectomy in 7 patients with microadenomas and in all 10 patients with macroadenomas. Thus, 88% of the patients with microadenomas and 59% of the patients with macroadenomas were cured, and the overall cure rate was 68%. We conclude that recurrence of acromegaly after successful surgery may occur late after adenoma removal and that it cannot be predicted by normal postoperative GH levels and dynamics. However, in view of the overall cure rate, transsphenoidal adenomectomy remains a most valuable treatment for acromegaly.     

Regulation of expression of the human interferon gamma gene.

DNA fragments isolated from a genomic clone of human gamma interferon (IFN-gamma) as well as IFN-gamma cDNA were used to map potential regulatory regions of the IFN-gamma gene by DNase I-hypersensitivity analyses. In nuclei from the human T-cell line Jurkat, which can be induced to express the IFN-gamma gene, we observed a strongly hypersensitive site in the first intervening sequence that localized to the only intracistronic repeat element in the gene. DNase I mapping of Jurkat cells was compared to that of several other cell types, including B cells, macrophages, and epithelial cells. The presence of strong intronic hypersensitivity was found only in cells capable of expressing the IFN-gamma gene. No hypersensitivity was found in the 3' regions of the gene. Further, no hypersensitivity was observed when purified genomic DNA from Jurkat was analyzed, suggesting that DNA-protein interactions, and not simply DNA sequence alone, were responsible for DNase I hypersensitivity. The sequence AAGTGTAATTTTTTGAGTTTCTTTT, which is directly in the intronic hypersensitive area of IFN-gamma, is 83% homologous to a nearly identical sequence in the 5' flanking region of the interleukin 2 gene. In interleukin 2, the homologous sequence is about 300 base pairs upstream of that gene's promoter in an area of potential regulatory importance.     

Richard B. Cattell: master surgeon, teacher, and innovator

Richard B. Cattell (1900-1964) was a general surgeon widely revered for his masterful technical skills and innovative approaches to complicated surgical cases. In addition to his surgical prowess, he fostered a deep commitment to medical education,but above all emphasized the importance of humanity inpatient care. He has left a remarkable legacy for present and future surgeons to strive to emulate. “To know him was to admire him, to respect him, and to love him. He was a magnificent physician who walked among the greatest, but never lost the common touch.     

CD4+CD25+ regulatory T cells mediate acquired transplant tolerance

The Holy Grail of clinical organ transplantation is the safe induction of allograft tolerance. Transplant tolerance has been successfully induced in animal models. Since T cells play a pivotal role in graft rejection, modulating T cell function has been the primary focus of studies aimed at inducing transplant tolerance. Rodent models of transplant tolerance induction include central deletion and peripheral mechanisms involving activation-induced cell death (AICD), anergy, immune deviation, and production of regulatory T cells. These mechanisms are not mutually exclusive. Although clonal deletion and anergy limit self-reactive T cells in the thymus, these mechanisms alone are not sufficient for controlling self-reactive T cells in the periphery. There is now evidence that the adult animal harbors two functionally distinct populations of CD4(+) T cells; one mediates autoimmune disease and the other dominantly inhibits it. The latter cells express CD4, CD25 and CTLA-4. These thymus-derived T cells have recently been shown to mediate the induction and maintenance of transplant tolerance. These CD4(+)CD25(+) T cells are similar in origin, phenotype, and function to those that maintain natural self-tolerance and T cell homeostasis in the periphery. Against this background, is it possible that alloantigen specific regulatory T cells might be generated and expanded ex vivo before organ transplantation and then infused to induce long-term tolerance, perhaps without the need for chronic immunosuppression?     

Men with nonobstructive azoospermia have Leydig cell hypertrophy but not hyperplasia

PURPOSE: We determined whether testicular histology in men with spermatogenic failure due to nonobstructive azoospermia shows true Leydig cell hyperplasia. MATERIALS AND METHODS: Testicular biopsy specimens from 17 patients evaluated for infertility were retrospectively analyzed. Interstitial, tubular and Leydig cell volume were quantitatively evaluated. The total volume and number of Leydig cells per testicle were then calculated. RESULTS: In 10 patients with obstructive azoospermia testicular histology showed normal spermatogenic function, while 7 had nonobstructive azoospermia. Average testicular volume plus or minus standard deviation was significantly larger in those with obstructive versus nonobstructive azoospermia (18.0 +/- 7.0 versus 9.3 +/- 8.7 cc, p = 0.025). Interstitial versus tubular volume was 32% of the total testis in the obstructive and 63% in the nonobstructive groups (p = 0.003). Although Leydig cell volume was proportionally greater in men with nonobstructive versus obstructive azoospermia (13.3% versus 0.05%, p = 0.045), there was no significant difference in the average number of Leydig cells per testicle (3.96 x 10 and 6.17 x 10, respectively, p = 0.16). The average volume of individual Leydig cells was significantly greater in men with the nonobstructive condition (253.0 +/- 98.7 versus 174.0 +/- 57.7 microm., p = 0.045). CONCLUSIONS: These results suggest that men with nonobstructive azoospermia and those with normal spermatogenesis have an equivalent number of Leydig cells. However, the Leydig cells are hypertrophic and occupy a larger proportion of total testis volume in men with nonobstructive azoospermia. Therefore, patients with spermatogenic failure show Leydig cell hypertrophy but not hyperplasia.     

Malignancy in a vestibular schwannoma. Report of a case with central neurofibromatosis,treated by both stereotactic radiosurgery and surgical excision,with a review of the literature

Malignant change in schwannoma is rare. Malignant change in a vestibular schwannoma (acoustic neuroma) is even more rare. This paper presents a case of rapidly growing vestibular schwannoma first treated by radiosurgery whose histopathology after surgical excision 42 months later showed malignant changes. Up to now, eight cases of malignancy in eighth nerve tumours have been reported, four of which, including the present case, had previously been treated with radiosurgery and four cases that had not received radiation. Thus, it would seem, the overall incidence is extremely low. Nevertheless, extreme vigilance and careful reporting continues to be necessary.     

Three-dimensional hindfoot motion in adolescents with surgically treated unilateral clubfoot

Advances in imaging and computerized analyses have enabled three-dimensional bone motion in the treated clubfoot to be measured precisely. Three-dimensional translations and rotations of the talus, calcaneus, navicular, and cuboid of surgically treated clubfeet were less in magnitude and sometimes different in direction (or without motion in a specific plane) compared with the contralateral normal feet. Surgical techniques used for clubfoot treatment do not restore normal hindfoot bone motion when examined with high-resolution magnetic resonance imaging, computer reconstruction, and image analysis techniques. These data advance the knowledge of hindfoot bone motion and establish a new and quantitative objective.