Benign osteoblastoma of the occipital bone: Case report and literature review

We present a case of benign osteoblastoma of the occipital bone. Benign osteoblastoma is an uncommon primary bone tumor, which usually involves the vertebrae and the long bones. This tumor rarely develops in the calvaria, showing a preference for the temporal and frontal bones when it does. To the best of our knowledge, this case is only the eighth reported case of benign osteoblastoma confined to the occipital bone. A 20‐year‐old male presented with a mild tender mass lesion of the occipital area, just below the lambda. Plain X‐ray films and CT scans demonstrated an osteolytic mass surrounded by the sclerotic rim within the diploic space. MRI proved to be effective for the evaluation of the intracranial and intraosseous extensions of the tumor. However, it was very difficult to formulate a differential diagnosis against other osteoblastic tumors, or osteoid osteoma, in view of its radiological appearance. The final diagnosis was obtained by careful consideration of the histopathological characteristics of the tumor combined with its clinical and radiological features. Although generally regarded as benign, a complete resection is preferred over conventional curettage as this can guard against possible recurrence and malignant transformation.     

Self‐reflection and self‐practice in training of Cognitive Behaviour Therapy: an overview

The present paper deals with a developing training element in cognitive behaviour therapy (CBT), the self‐practice of therapeutic techniques and the self‐exploration of the person of the therapist. Initially, the current status of this training element in CBT is discussed, and a short note on its terminology is presented. Then an overview of the most important objectives of self‐practice and self‐reflection in CBT, and the concepts and methods of practice of this element is given. The concepts focus on two major aims, the self‐exploration of the person of the therapist within and beyond his or her therapeutic practice, and the self‐application of therapeutic techniques (= self‐practice). In the second part of the paper empirical studies related to the outcome of self‐reflection and self‐practice on the development of the therapist and her or his therapeutic practice are reviewed. The few empirical studies show that trainees experience in their own view substantial professional and personal gains from this training tool, with the professional impact being more important than the personal one. The most important outcomes evaluated by subjective data from the trainees are improvements in self‐insight and self‐awareness and a better understanding of the therapist's role and the therapeutic change process. Additionally, a better understanding of CBT methods and of general therapeutic skills, such as empathy and role‐taking‐competencies, are reported by the trainees. The paper comes to the conclusion that self‐exploration and self‐practice are important components of CBT training. Consequences and recommendations for its integration into training courses for CBT are discussed as well as the necessity for more research in this area. Copyright © 2002 John Wiley & Sons, Ltd.     

Ultrasound diagnosis of fetal lung maturity--a new method]

First results are presented to determine the maturity of fetal lung by sonography. Using the fetal liver as a reference-organ we are avoiding the known pitfalls which made it impossible in the past to standardize the fetal lung changes depending on the age of gestation. We examined 104 patients between week 27 and week 41. In one ultrasound section cut we depicted as well lung and liver. According to the known A-mode we registered frequencies in both organs. The registered frequencies were entered digitally into a computer and checked for f(mean), f(max) and f(min). Afterwards the frequencies of the lung were divided by those of the liver. Of all weeks of gestation the mean value and standard deviation were calculated. We found the liver as an adequate reference-organ, since there is no change of the reflection pattern between the different weeks of gestation, while there are significant changes to be registered in the fetal lung, a cutting line being week 35. A quotient of f(mean) lower than 1.1 hints to lung maturity while values over 1.1 point to immaturity. This was confirmed by several cases of analysis of amniotic fluid (L/S-ratio). Further comparisons with amniotic fluid results will have to validate these findings.     

The effect of combinations of ampligen and zidovudine or dideoxyinosine against human immunodeficiency viruses in vitro.

The combinations of ampligen and zidovudine at ratios of 100:1, 25:1, 10:1, and 1:50 acted synergistically to reduce cytopathology caused by HIV in MT-2 cell cultures. Combination indices were less than 1 at all of these ratios representing different combinations of concentrations and at 3 effective doses (ED30, ED50, ED70). Combination of drugs which show synergism at a wide range of ratios of combinations suggest that they may be useful clinically, and that the antiviral efficacy of ZDV may be increased in combination with ampligen. Synergism was also found between ampligen and zidovudine by reduction of HIV-produced plaques in a HeLa cell line expressing CD-4 receptors. However the combination of ampligen and dideoxyinosine against HIV in MT-2 cells was only additive and not synergistic.     

Polymorphisms in manganese superoxide dismutase and catalase genes: functional study in Hong Kong Chinese asthma patients

BACKGROUND: Reactive oxygen species may contribute to the pathogenesis of asthma. Functional genetic polymorphisms of antioxidant enzymes, superoxide dismutase (SOD) and catalase are good candidates for asthma susceptibility. OBJECTIVE: To investigate the association of the manganese-containing form of SOD (MnSOD) gene at amino acid position 16 (Val16Ala) and catalase gene in the promoter at A-21T and C-262T polymorphisms and asthma in a Hong Kong Chinese population. METHODS: The association study was conducted in a case-control design in asthma patients (n=251) and healthy controls (n=316) by genotyping. The functional significance was assessed by determining erythrocyte SOD and catalase activity. RESULTS: The Val allele of MnSOD at Val16Ala and the A allele of catalase gene at A-21T were not different between patients and controls, while the C allele of catalase gene at C-262T was found to be significantly different between patients and controls (P=0.033). The less frequent variant of catalase gene (-262T) was found to be protective from the development of asthma in a Hong Kong Chinese non-smoking population (adjusted odds ratio=0.35, 0.15-0.85; P=0.017). Asthma patients had elevated erythrocyte SOD and catalase activities in comparison with healthy controls (P<0.01). However, their activities were not associated with different genotypes within healthy controls or asthma patients. CONCLUSION: This is the first report showing that SOD and catalase functional activities are not associated with their respective genetic polymorphisms but related to the presence of asthma in a Hong Kong Chinese population.     

Nucleotide changes around the splicing acceptor of intron 24 in the factor VIII gene and its impact on splicing.

Nucleotide 6724 of the factor VIII gene harbors a polymorphism of low frequency. A report from Taiwan claimed that 97.9% of the 83 alleles examined were of the A nucleotide at this position, which is quite different to the data from Western populations. Furthermore, this nucleotide is the start of exon 25, located in juxtaposition to the splicing acceptor of intron 24. We wonder if the nucleotide change at this location might have any effect on the splicing process of pre-mRNA. Using genomic DNA with direct sequencing of the polymerase chain reaction-amplified intron 24/exon 25 junction site, we found that 59 of the 60 patient samples were of the GTG sequence at nucleotides 6724-6726. The polymorphism is similar between populations in Taiwan and Western countries. The sequence of intron 24 around the splicing acceptor was always TCCAACTCTATTGCCCTCAG (-20 to -1), except for one hemophiliac patient who had a mutation in which the absolute consensus AG doublet of the intron 24 splicing acceptor changed to the AA dinucleotide. Owing to the mutation, exon 24 was erroneously spliced to exon 26, and exon 25 was skipped. This finding further testifies to the importance of the invariant AG dinucleotide in the example of the factor VIII gene.     

Tests for latent tuberculosis

Sir, In their article, Shankar and colleagues underline the significantburden of tuberculosis within their population and the importanceof identifying latent infection