Mouse models of atopic eczema critically evaluated

Atopic eczema (AE) is a chronic relapsing inflammatory skin disorder with increasing prevalence in Western societies. Even though we have made considerable progress in understanding the cellular and molecular nature of cutaneous inflammation, the precise pathomechanisms of AE still remain elusive. Experimental animal models are indispensable tools to study the pathogenic mechanisms and to test novel therapeutic approaches in vivo. For AE a considerable number of mouse models have been proposed and have been used to study specific aspects of the disease, such as genetics, skin barrier defects, immune deviations, bacteria-host interactions or the role of cytokines or chemokines in the inflammatory process. While some models closely resemble human AE, others appear to reflect only specific aspects of the disease. Here we review the currently available mouse models of AE in light of the novel World Allergy Organization classification of eczematous skin diseases and evaluate them according to their clinical, histopathological and immunological findings. The pathogenetic analogies between mice and men will be discussed.     

Reliable detection of macrolide-resistant Helicobacter pylori via fluorescence in situ hybridization in formalin-fixed tissue.

Macrolide-resistant Helicobacter (H.) pylori represent an increasing therapeutic problem. Macrolide resistance is usually determined phenotypically in vitro with methods such as E-test or agar dilution test. A prerequisite for those tests, however, is bacterial culture that is not routinely set up in the course of gastroscopy. In contrast, formalin-fixed, paraffin-embedded biopsies are regularly available from patients who have undergone gastroscopy. In such biopsies macrolide-resistant H. pylori can be detected by the genotype-based technique of fluorescence in situ hybridization (FISH). Experience gained by this new method, however, is still extremely limited, especially in formalin-fixed tissue. Therefore, we retrospectively investigated formalin-fixed, paraffin-embedded biopsy specimens by FISH in 104 patients suffering from therapy-resistant H. pylori gastritis. To test the accuracy of FISH, we initially examined specimens from 53 patients for whom results of the E-test were available. Next we analyzed biopsies from another 51 patients that had been selected since phenotypical resistance testing had failed despite documented culturing attempts. In all 104 patients, H. pylori was detected by FISH and could thus be investigated for macrolide resistance. Overall, macrolide-resistant bacteria were found in 71 patients (68.3%). In 49 of 53 patients (92.4%), FISH and E-test returned identical results (no significant discordance according to McNemar's chi(2)-test). Taken together, our study demonstrates that FISH is a highly sensitive and reliable method for detecting macrolide-resistant H. pylori in formalin-fixed, paraffin-embedded biopsy specimens, which represents the routine method of processing tissue obtained upon gastroscopy.     

Pathophysiologic concentrations of lysophosphoglycerides quantified by electron microscopic autoradiography

Lysophosphoglycerides accumulate in ischemic myocardium and appear to contribute to malignant dysrhythmia. Exposure of normoxic isolated Purkinje fibers or ventricular muscle strips to exogenous lysophosphatidyl choline (LPC) results in rapid, yet reversible, electrophysiologic derangements analogous to changes associated with ischemia in vivo. However, subcellular, local concentrations required for induction of electrophysiologic effects have not yet been elucidated unambiguously. The present study was designed to delineate the subcellular distribution and the sarcolemmal concentration of LPC by quantitative electron microscopic autoradiography after exposure of canine ventricular muscle strips to 3H-methyl LPC (200 microM) for 10 minutes. Tissue was processed for electron microscopy with a new procedure developed specifically to spatially fix choline phosphatides and render them insoluble in lipid solvents. Grain distributions were analyzed in the same group of cells that had been monitored electrophysiologically while superfused with LPC. LPC significantly decreased the resting membrane potential, action potential amplitude, duration, Vmax of phase 0, and conduction time. Grains were concentrated in the membranous organelles of cardiac myocytes. Myocyte sarcolemma exhibited the highest grain density (129 grains/100 micron2 versus a background of 0.27 grains/100 micron2). Calculations based on grain densities, emulsion sensitivity, exposure time, and specific activity indicated that the sarcolemma incorporated 5.4 X 10(6) LPC molecules/micron3 of membrane volume corresponding to approximately 1% of total sarcolemmal phospholipid. Since incorporation of only this small amount of lysophosphoglyceride into the sarcolemma was sufficient to elicit electrophysiologic disturbances, the observed accumulation of lysophosphoglycerides induced by ischemia appears to be sufficient to contribute to malignant dysrhythmia in vivo.     

Terminal sequences of Sindbis virus-specific nucleic acids: Identity in molecules synthesized in vertebrate and insect cells and characteristic properties of the replicative form RNA

The terminal sequences of the virus-specific nucleic acids synthesized in BHK vertebrate cells and in Aedes albopictus insect cells infected with the alphavirus Sindbis virus have been analyzed. The 26 S and 42 S plus-strand RNA molecules have the 5′-terminal sequences m⁷GpppAUAG and m⁷GpppAUAGGCGGCGUAGUACACAC, respectively. A 22 S replicative form (RF) RNA which contains an infectious 42 S plus-strand genome RNA molecule and a complementary 42 S negative-strand RNA accumulates in infected cells. The 5′-terminal sequence of the 42 S plus-strand RNA component of the RF is identical to that of the single-stranded plus-strand 42 S RNA molecule except for the absence of a 5′-terminal cap in the constituent of the RF RNA. The identification of a poly(U) sequence at the 5′-terminus of the 42 S minus strand RNA in our experiments is in accordance with earlier results obtained in other laboratories (Sawicki and Gomatos, 1976; Frey and Strauss, 1978). Analogous to our data concerning the structure of the RF RNA of the alphavirus Semliki Forest virus (Wengler et al., 1979) the 3′-terminus of the 42 S minus strand RNA component of the Sindbis virus-specific RF RNA is complementary to the 5′-terminus of the 42 S plus strand RNA molecule but in addition contains a 3′-terminal extra unpaired guanosine residue. The 3′-terminal sequence of the 42 S minus strand is strongly conserved between the two alphaviruses, Sindbis virus and Semliki Forest virus. The terminal sequences of the RF RNA synthesized in BHK and Aedes albopictus cells are identical. Analyses of the capped oligonucleotides derived from virus-specific single-stranded 42 S plus-strand RNA and from 26 S RNA strongly indicate that no base sequence differences exists between the corresponding molecules synthesized in either vertebrate or insect cells. Possible implications of these findings concerning the structure of alphavirus RF RNA and the synthesis of alphavirus-specific nucleic acids are discussed.     

Ionic conductances of cultured principal cell epithelium of renal collecting duct

The ionic conductive properties were studied of epithelia of collecting duct principal cells which had been grown in primary tissue culture from renal cortex/capsule explants. When pretreated with aldosterone (10^–6 mol/l) and bathed on either surface with isotonic HCO ₃ ^– -free Ringer's solution, the transepithelial voltage,V _te, varied between –21 and –72 mV (apical surface negative) while the transepithelial resistance,R _te, ranged from 0.4 to 1.5 kcm². By 10:1 step-changes in Na⁺ concentration the apical cell membrane was shown to have a high conductivity for sodium, inhibitable by amiloride, 10^–6 mol/l. However, contrary to observations in natural collecting duct under control conditions, amiloride never reversed the polarity ofV _te even at 10^–4 mol/l. Both the apical and the basolateral cell membranes were conductive for potassium and both conductivities were inhibitable by Ba²⁺ (5 mmol/l). 10:1 reduction of apical Cl^– concentration strongly hyperpolarizedV _te with a monophasic time course suggesting the presence of a paracellular shunt conductance for Cl^–. In addition there may be a small Cl^– conductance present in the apical cell membrane since apical application of the chloride channel blocker 5-nitro-2-(3-phenylpropylamino)-benzoic acid (NPPAB) at 10^–7 mol/l produced a minute but significant hyperpolarization. On the other hand, 10:1 reduction of basolateral Cl^– concentration caused a biphasic change inV _te (initial depolarization, followed by repolarization) which indicates the presence of a large Cl^– conductance in the basolateral cell membrane. The latter was not inhibitable by 10^–7 mol/l NPPAB. Higher concentrations of this and of an other Cl^– channel blocker produced non-specific effects. In conclusion, our studies of a pure principal cell epithelium confirm findings described for the intact cortical collecting duct and add new information concerning chloride conductivity and related blocking agents.Dedicated to Prof. Dr. H. Sitte, Homburg, FRG, upon his 60th birthday.     

Individual differences in cognitive reappraisal: experiential and physiological responses to an anger provocation.

Effective emotion regulation is widely seen as vital for healthy adaptation. There remains considerable uncertainty, however, as to what constitutes effective emotion regulation. One promising emotion regulation strategy is cognitive reappraisal, which involves reframing emotional events so as to decrease their emotional impact. This strategy is useful because it seems to enable individuals to down-regulate negative feelings without the physiological costs that are associated with other forms of emotion regulation. It remains unknown, however, whether individual differences in the use of reappraisal are associated with experiential and physiological responses to anger-inducing situations. To examine this question, individuals either high or low in reappraisal were made angry in the laboratory while emotion experience and cardiovascular responses were assessed. Results indicated that compared to low reappraisers, high reappraisers had a more adaptive profile of emotion experience and cardiovascular responding. Specifically, across baseline and provocation periods, high reappraisers reported less anger, less negative emotion, and more positive emotion, showed greater cardiac output and ventricular contractility, and lesser total peripheral resistance. These findings suggest that reappraisers are successful at down-regulating negative emotions, even in the context of a potent negative emotion such as anger.     

Buchbesprechungen

Ohne Zusammenfassung