Urinary dialkylphosphate metabolites and health symptoms among farmers in Thailand

Using a cross-sectional study, we investigated urinary DAPs levels and health symptoms related to the type of crop cultivation and farm tasks among 84 farmers in Phayao Province of northern Thailand. The results showed that the average of ∑DAPs levels was 10.93 ± 19.64 μg/g creatinine (range 1.48–163.90 μg/g creatinine). The compound found the most was DEP, followed by DETP, DEDTP, DMP, DMTP, and DMDTP, respectively. The type of crop cultivation may be associated with an increasing prevalence of respiratory tract, muscle system, and skin irritation. Farm tasks were associated with an increasing prevalence of muscle system and skin irritation. It was difficult to assess adverse health symptoms associated with urinary DAPs in low levels of exposure; therefore, further investigation is needed using more sensitive biomarkers and more sensitive health symptom measurement.     

Induction of Human Hepatocellular Carcinoma HepG2 Cell Apoptosis by Naringin

Naringin, a bioflavonoid found in Citrus seeds, inhibits proliferation of cancer cells. The objectives of this study were to investigate the mode and mechanism(s) of hepatocellular carcinoma HepG2 cell death induced by naringin. The cytotoxicity of naringin towards HepG2 cells proved dosedependent, measured by MTT assay. Naringintreated HepG2 cells underwent apoptosis also in a concentration related manner, determined by annexin Vfluorescein isothiocyanate (FITC) and propidium iodide (PI) employing flow cytometry. Mitochondrial transmembrane potential (MTP) measured using 3,3dihexyloxacarbocyanine iodide (DiOC6) and flow cytometer was reduced concentrationdependently, which indicated influence on the mitochondrial signaling pathway. Caspase3, 8 and 9 activities were enhanced as evidenced by colorimetric detection of paranitroaniline tagged with a substrate for each caspase. Thus, the extrinsic and intrinsic pathways were linked in human naringintreated HepG2 cell apoptosis. The expression levels of proapoptotic Bax and Bak proteins were increased whereas that of the antiapoptotic BclxL protein was decreased, confirming the involvement of the mitochondrial pathway by immunoblotting. There was an increased expression of truncated Bid (tBid), which indicated caspase8 proteolysis activity in Bid cleavage as its substrate in the extrinsic pathway. In conclusion, naringin induces human hepatocellular carcinoma HepG2 cell apoptosis via mitochondriamediated activation of caspase9 and caspase8mediated proteolysis of Bid. Naringin anticancer activity warrants further investigation for application in medical treatment.     

Ethanolic extract of fermented Thunb induces human leukemic HL-60 and Molt-4 cell apoptosis via oxidative stress and a mitochondrial pathway

Houttuynia cordata Thunb (HCT) is a medicinal plant of the Saururaceae family which features antimutagenic and antiviral properties. For extraction, the whole plants were fermented or non-fermented with yeast and ethanol then the whole plants were dried, ground and extracted with 95% ethanol or water. The aims of this study were to compare cytotoxic effects, apoptosis induction, and mechanism(s) with the ethanolic and water extracts of fermented and non-fermented HCT. Cytotoxicity was assessed using the MTT assay in human leukemic HL-60, Molt-4 and peripheral blood mononuclear cells (PBMCs). Apoptotic death was characterized by staining with propidium iodide and examined under a fluorescence microscope. Peroxide radical production and reduction of mitochondrial transmembrane potential (MTP) were determined using 2',7'-dichlorohydrofluorescein diacetate and 3,3'-dihexyloxacarbocyanine iodide and flow cytometry, respectively. The expression of caspase-9 was identified by immunoblotting. The ethanolic extract of fermented HCT was cytotoxic to HL-60 >Molt- 4 > PBMCs, to a greater extent than the non-fermented preparation and the number of apoptotic cells was higher. The alcoholic (fermented) extract produced more radicals than the non-fermented in HL-60 cells but the converse was observed in Molt-4 cells. Reduction of MTP was found in HL-60 and Molt-4 cells treated with the alcoholic (fermented) extract and caspase-9 was cleaved dose-dependently in both cells. In conclusion, the alcoholic extract of fermented HCT was more toxic to human leukemic cells than the non-fermented and both cell lines underwent apoptosis via oxidative stress and a mitochondrial pathway.     

Decreased expression of complement 3a receptor (C3aR) in human placentas from severe preeclamptic pregnancies

Objectives

The aim of this study was to determine the expression of the anaphylatoxin receptors complement C3a receptor (C3aR) and C5a receptor (C5aR) in the placentas of pregnancies complicated by severe early onset preeclampsia.

Study design

We recruited women with pregnancies complicated by severe early-onset preeclampsia (n = 19, 11 of which were further complicated with IUGR) and women with preterm pregnancies not affected by preeclampsia (n = 8). Gene and protein expression of C3aR and C5aR was analysed by quantitative RT-PCR and Western blotting, respectively.

Results

C3aR was detected in the Hofbauer cells in the villous stroma of the placenta. C5aR staining was detected in the syncytiotrophoblast and endothelial cells. We found significantly decreased expression of C3aR mRNA and protein expression in placentas with preeclampsia compared to controls. However, C5aR expression was not significantly different between preeclamptic and control placentas at either the mRNA or protein level.

Conclusions

Decreased C3aR expression indicates a dysregulation of the complement system in the placentas of preeclamptic women. Further studies would elucidate the exact mechanisms that complement has in preeclampsia.     

The Effects of Ibuprofen,Naproxen and Diclofenac on cell Apoptosis,Cell Proliferation and Histology Changes in Human Cholangiocarcinoma Cell Lines

Objective: To examine the effects of ibuprofen, naproxen and diclofenac, non-steroidal anti-inflammatory drugs (NSAIDs) on cell proliferation activity of the human CCA cell lines. Methods: KKU-M139 and KKU-213B cell lines were used in this study. The cell viability was assessed by the MTT assay. Lipid synthesis determined by Oil red O staining and colorimetric assay. An inverted phase-contrast light microscope was used to investigate the histological change of the cells. Caspases 3/7 activity and AnnexinV/PI were used to assess apoptosis by multiple microplate reader. Results: The results showed that ibuprofen, naproxen and diclofenac suppressed the viability of the KKU-M139 and KKU-213B cells in a dose-dependent manner, as measured especially diclofenac. However, these three NSAIDs slightly decreased lipid synthesis determined by Oil red O staining and colorimetric assay. The histological change observations showed the shrinking cell and become star-shaped in high dose treated groups. Interestingly, these NSAIDs exhibited in both of KKU-M139 and KKU-213B cell lines, the diclofenac-treated cells had the most injury cells. The cells exhibited cell injury features. In addition, the detection of caspase 3/7 and AnnexinV/PI in this investigation revealed early cell apoptotic characteristics. Conclusion: These finding suggest that ibuprofen, naproxen and diclofenac suppress cell viability. The results reveal that ibuprofen, naproxen and diclofenac, which induce the histological change and apoptosis. This study indicates that these NSAIDs may be used as an anti-proliferation agent for the treatment of CCA in the future.     

Antibiograms and randomly amplified polymorphic DNA‐polymerase chain reactions (RAPD‐PCR) as epidemiological markers of gonorrhea

The development of antimicrobial resistance of Neisseria gonorrhoeae arising from wide dissemination of resistant clones is a major global health problem. In this study, a total of 235 isolates of N. gonorrhoeae isolated from patients of Bangrak Hospital were tested for their antibiotic susceptibilities to penicillin, norfloxacin, ofloxacin, ciprofloxacin, spectinomycin, and ceftriaxone. Mutation (Ser‐91) in the quinolone resistance determining regions of gyrA and random amplification of the polymorphic DNA polymerase chain reaction (RAPD‐PCR) were examined from 145 isolates. Among these, 55 isolates were obtained during January–March 2000, 46 isolates during January–March 2002, and 44 isolates during October–December 2002. The occurrence of combination resistance between penicillin and quinolone was 20% in January–March 2000, which was increased to 57.8% during the period of October–December 2002 (P<0.0001). Mutation of Ser‐91 in gyrA could be directly linked with the resistance or declining of susceptibility to ciprofloxacin. Using RAPD‐PCR, we could classify the 145 isolates into 4 and 5 groups by primers D11344 (5′‐AGTGAATTCGCGGTGAGATGCCA‐3′) and D8635 (5′‐GAGCGGCCAAAGGGAGCA GAC‐3′), respectively. Combination of the data obtained from these two primers produced 11 fingerprint groups. Our findings conclude that monitoring of the Ser‐91 mutation of gyrA and RAPD‐PCR methods are most useful for epidemiological screening. J. Clin. Lab. Anal. 24:31–37, 2010. © 2010 Wiley‐Liss, Inc.     

A long‐term survey on the distribution of the human rotavirus G type in Thailand

The distribution of the G type of human rotavirus was surveyed in Thailand between July 1993 and June 2007. A significant yearly change in the distribution of the G type distribution was found. From 1993–1994 to 1998–1999, the G1 type was the most dominant. In 1999–2000, G9 began to appear at a high frequency. In 2000–2001, 2001–2002, and 2002–2003, G9 was very common. In 2003–2004, G1 became the most prevalent type again, and since then it has been detected at the highest frequency. G12 strains, which were first detected in 1998–1999, were also found in 2004–2005 and 2006–2007. The G4 and G3 types were moderately prevalent in 2001–2002 and 2004–2005, respectively. Nucleotide sequence analysis of the VP7 genes of the G9 and G12 strains which reemerged in Thailand showed that they were each similar to the contemporary strains in other countries. J. Med. Virol. 82:157–163, 2010. © 2009 Wiley‐Liss, Inc.     

Bacteria Associated with Echinodorus cordifolius and Lepironia articulata Enhance Nitrogen and Phosphorus Removal from Wastewater

Phytoremediation and bioremediation are eco-friendly methods of wastewater treatment that are widely used throughout the world to reduce anthropogenic water contamination. This study was conducted to assess the effectiveness of symbiotic bacteria in phytoremediation using two aquatic plants, Echinodorus cordifolius and Lepironia articulata, that were tested in sterilized and unsterilized groups. The results showed that unsterilized plants removed more phosphate, ammonium, nitrate and nitrite than the sterilized plants. In untreated and unsterilized E. cordifolius groups, the dominant bacterium was Calothrix (46.90 and 49.69%, respectively), which was higher than in the sterilized E. cordifolius group (38.88%). In untreated and unsterilized groups of L. articulata, Clostridium was a dominant bacterium. The proportion of Clostridium was much lower in the sterilized L. articulata group (1.31%) than in the untreated (13.71%) and unsterilized (49.02%) groups. Our results suggested that root-associated bacteria in E. cordifolius and L. articulata were effective in the removal of phosphorus and nitrogen from domestic wastewater.