Human spumaretrovirus antibody reactivity in multiple sclerosis

The role of human spumaretrovirus (HSRV) infections in the pathogenesis of multiple sclerosis (MS) was investigated with recombinant HSRV env-specific enzyme-linked immunosorbent assay. The presence of HSRV antibodies was determined in pairs of serum and cerebrospinal fluid (CSF) samples from 60 MS patients. In 7 of these patients serial serum and CSF samples were obtained in relation to the clinical activity of the disease during a period of 2 years. No increased antibody reactivity was demonstrable in the MS population compared with 14 aseptic meningitis patients, 50 blood donors and 16 healthy controls. Slightly elevated levels of antibodies were demonstrable in serum and/or CSF in 4 MS patients but also in 1 patient with aseptic meningitis, 1 blood donor and 1 child. No marked serum or CSF HSRV antibody fluctuation was observed in the MS patients followed longitudinally. Thus, this study does not support the involvement of HSRV in the pathogenesis of MS.     

Recommendations for participation in leisure-time physical activity and competitive sports of patients with arrhythmias and potentially arrhythmogenic conditions. Part II: ventricular arrhythmias, channelopathies and implantable defibrillators.

This consensus paper on behalf of the Study Group on Sports Cardiology of the European Society of Cardiology follows a previous one on guidelines for sports participation in competitive and recreational athletes with supraventricular arrhythmias and pacemakers. The question of imminent life-threatening arrhythmias is especially relevant when some form of ventricular rhythm disorder is documented, or when the patient is diagnosed to have inherited a pro-arrhythmogenic disorder. Frequent ventricular premature beats or nonsustained ventricular tachycardia may be a hallmark of underlying pathology and increased risk. Their finding should prompt a thorough cardiac evaluation, including both imaging modalities and electrophysiological techniques. This should allow distinguishing idiopathic rhythm disorders from underlying disease that carries a more ominous prognosis. Recommendations on sports participation in inherited arrhythmogenic conditions and asymptomatic gene carriers are also discussed: congenital and acquired long QT syndrome, short QT syndrome, Brugada syndrome, catecholaminergic polymorphic ventricular tachycardia, arrhythmogenic right ventricular cardiomyopathy and other familial electrical disease of unknown origin. If an implantable cardioverter defibrillator is indicated, it is no substitute for the guidelines relating to the underlying pathology. Moreover, some particular recommendations for patients/athletes with an implantable cardioverter defibrillator are to be observed.     

Acute effects of the ampakine farampator on memory and information processing in healthy elderly volunteers.

Ampakines act as positive allosteric modulators of AMPA-type glutamate receptors and facilitate hippocampal long-term potentiation (LTP), a mechanism associated with memory storage and consolidation. The present study investigated the acute effects of farampator, 1-(benzofurazan-5-ylcarbonyl) piperidine, on memory and information processes in healthy elderly volunteers. A double-blind, placebo-controlled, randomized, cross-over study was performed in 16 healthy, elderly volunteers (eight male, eight female; mean age 66.1, SD 4.5 years). All subjects received farampator (500 mg) and placebo. Testing took place 1 h after drug intake, which was around Tmax for farampator. Subjects performed tasks assessing episodic memory (wordlist learning and picture memory), working and short-term memory (N-back, symbol recall) and motor learning (maze task, pursuit rotor). Information processing was assessed with a tangled lines task, the symbol digit substitution test (SDST) and the continuous trail making test (CTMT). Farampator (500 mg) unequivocally improved short-term memory but appeared to impair episodic memory. Furthermore, it tended to decrease the number of switching errors in the CTMT. Drug-induced side effects (SEs) included headache, somnolence and nausea. Subjects with SEs had significantly higher plasma levels of farampator than subjects without SEs. Additional analyses revealed that in the farampator condition the group without SEs showed a significantly superior memory performance relative to the group with SEs. The positive results on short-term memory and the favorable trends in the trail making test (CTMT) are interesting in view of the development of ampakines in the treatment of Alzheimer's disease and schizophrenia.     

Polymorphisms in manganese superoxide dismutase and catalase genes: functional study in Hong Kong Chinese asthma patients

BACKGROUND: Reactive oxygen species may contribute to the pathogenesis of asthma. Functional genetic polymorphisms of antioxidant enzymes, superoxide dismutase (SOD) and catalase are good candidates for asthma susceptibility. OBJECTIVE: To investigate the association of the manganese-containing form of SOD (MnSOD) gene at amino acid position 16 (Val16Ala) and catalase gene in the promoter at A-21T and C-262T polymorphisms and asthma in a Hong Kong Chinese population. METHODS: The association study was conducted in a case-control design in asthma patients (n=251) and healthy controls (n=316) by genotyping. The functional significance was assessed by determining erythrocyte SOD and catalase activity. RESULTS: The Val allele of MnSOD at Val16Ala and the A allele of catalase gene at A-21T were not different between patients and controls, while the C allele of catalase gene at C-262T was found to be significantly different between patients and controls (P=0.033). The less frequent variant of catalase gene (-262T) was found to be protective from the development of asthma in a Hong Kong Chinese non-smoking population (adjusted odds ratio=0.35, 0.15-0.85; P=0.017). Asthma patients had elevated erythrocyte SOD and catalase activities in comparison with healthy controls (P<0.01). However, their activities were not associated with different genotypes within healthy controls or asthma patients. CONCLUSION: This is the first report showing that SOD and catalase functional activities are not associated with their respective genetic polymorphisms but related to the presence of asthma in a Hong Kong Chinese population.     

The small ptotic breast: reposition autoaugmentation mammaplasty

Autoaugmentation mammaplasty of the small ptotic breast with adjacent pedicled fat and simultaneous correction of ptosis is presented. The operative procedure is described and some representative results are shown.     

Nucleotide changes around the splicing acceptor of intron 24 in the factor VIII gene and its impact on splicing.

Nucleotide 6724 of the factor VIII gene harbors a polymorphism of low frequency. A report from Taiwan claimed that 97.9% of the 83 alleles examined were of the A nucleotide at this position, which is quite different to the data from Western populations. Furthermore, this nucleotide is the start of exon 25, located in juxtaposition to the splicing acceptor of intron 24. We wonder if the nucleotide change at this location might have any effect on the splicing process of pre-mRNA. Using genomic DNA with direct sequencing of the polymerase chain reaction-amplified intron 24/exon 25 junction site, we found that 59 of the 60 patient samples were of the GTG sequence at nucleotides 6724-6726. The polymorphism is similar between populations in Taiwan and Western countries. The sequence of intron 24 around the splicing acceptor was always TCCAACTCTATTGCCCTCAG (-20 to -1), except for one hemophiliac patient who had a mutation in which the absolute consensus AG doublet of the intron 24 splicing acceptor changed to the AA dinucleotide. Owing to the mutation, exon 24 was erroneously spliced to exon 26, and exon 25 was skipped. This finding further testifies to the importance of the invariant AG dinucleotide in the example of the factor VIII gene.     

Tests for latent tuberculosis

Sir, In their article, Shankar and colleagues underline the significantburden of tuberculosis within their population and the importanceof identifying latent infection     

Identification of a parathyroid hormone in the fish Fugu rubripes.

A PTH gene has been isolated from the fish Fugu rubripes. The encoded protein of 80 amino acid has the lowest homology with any of the PTH family members. Fugu PTH(1-34) had 5-fold lower potency than human PTH(1-34) in a mammalian cell system. INTRODUCTION: Parathyroid hormone (PTH) is the major hypercalcemic hormone in higher vertebrates. Fish lack parathyroid glands, but there have numerous attempts to identify and isolate PTH from fish. MATERIALS AND METHODS: Polymerase chain reaction (PCR) was performed with primers based on preliminary data from the Joint Genome Institute database. PCR amplification was performed on genomic DNA isolated from Fugu rubripes. PCR products were purified and DNA was sequenced. All sequence was confirmed from more than one independently amplified PCR product. Multiple sequence alignments were carried out, and the percentage of identities and similarities were calculated. An unrooted phylogenetic tree, using all the known PTH and PTH-related protein (PTHrP) amino acid sequences, was determined. Synthetic peptides were tested in a biological assay that measured cyclic adenosine 3',5'-monophosphate formation in UMR106.1 cells. Rabbit polyclonal antisera specific for N-terminal human PTHrP and one rabbit polyclonal antiserum specific for N terminus hPTH were used to test the cross-reactivity with fPTH(1-34) in immunoblots.