Serum gastrin levels in children with peptic ulcer disease.

Fasting serum gastrin values were measured by radioimmunoassay in 53 children with peptic ulcer disease. The mean fasting serum gastrin levels for children with chronic duodenal ulcer, acute gastric ulcer, acute duodenal ulcer who were younger than two years old and acute duodenal ulcer who were older than two years old were: 46.2 +/- 25.7 pg/mL, 46.9 +/- 43.5 pg/mL, 47.9 +/- 12.0 pg/mL and 37.5 +/- 17.8 pg/mL, respectively. Children with peptic ulcer disease did not have elevated fasting serum gastrin levels when compared with age-matched controls. We conclude that a fasting serum gastrin value cannot be used as a screening test for peptic ulcer disease in children, except for Zollinger-Ellison syndrome.     

The role of endothelin-1 during ischemia-reperfusion injury.

In order to investigate the role of endothelin-1 during ischemia-reperfusion injury, 80 adult male Wistar rats were subjected to three hours of ischemia and one hour of reperfusion. Animals were evenly divided into eight groups. The rats in group 1 served as the normal control group, while the rats in group 2 received an intravenous infusion of endothelin-1 in a dosage of 0.5 ng/kg/min, group 3 in a dosage of 5 ng/kg/min, and group 4 in a dosage of 50 ng/kg/min. The rats in group 5 were infused with angiotensin II (10 ng/kg/min). The rats in group 6 received an intravenous infusion of 10,000 units of superoxide dismutase and 10,000 units of catalase. Group 7 rats were infused with endothelin-1 (50 ng/kg/min), superoxide dismutase (10,000 units), and catalase (10,000 units). Group 8 rats received an infusion of angiotensin II (10 ng/kg/min), superoxide dismutase (10,000 units) and catalase (10,000 units). The infusions were given during the reperfusion period. After one hour of reperfusion, the gastrocnemius and soleus muscles of the experimental animals were excised and assayed for ischemia-reperfusion injury by measuring triphenyltetrazolium chloride (TTC) reduction. The results showed that the limb activity of the ischemic extremity was 40.33 +/- 2.75% in group 1, 41.62 +/- 4.08% in group 2, 14.42 +/- 3.14% in group 3, 4.43 +/- 1.05% in group 4, 23.81 +/- 3.51% in group 5, 57.23 +/- 4.52% in group 6, 31.79 42- 3.63% in group 7, and 27.39 +/- 3.95% in group 8. Endothelin-1 reduced the limb activity in a dose-dependent manner.(ABSTRACT TRUNCATED AT 250 WORDS)     

Hemiparkinsonism in a patient with frontal meningioma.

We report on a 44-year-old woman with a right frontal meningioma, who presented with resting tremor, rigidity and bradykinesia in the left limbs. There were no other neurologic manifestations. A computed tomography scan demonstrated a huge high-density mass in the right frontal lobe and marked surrounding edema causing compression of the basal ganglia. Cerebral angiography showed a typical sunburst tumor stain and three feeding vessels from the bilateral middle meningeal arteries and the right callosomarginal artery. The pathologic diagnosis was transitional type meningioma. Before surgery, treatment with levodopa and bromocriptine was significantly effective in controlling hemiparkinsonism, which completely disappeared after surgical removal of the tumor. This outcome supports the notion that local compression due to edema may cause a functional disorder in the basal ganglia producing reversible contralateral parkinsonism.     

The effect of combinations of ampligen and zidovudine or dideoxyinosine against human immunodeficiency viruses in vitro.

The combinations of ampligen and zidovudine at ratios of 100:1, 25:1, 10:1, and 1:50 acted synergistically to reduce cytopathology caused by HIV in MT-2 cell cultures. Combination indices were less than 1 at all of these ratios representing different combinations of concentrations and at 3 effective doses (ED30, ED50, ED70). Combination of drugs which show synergism at a wide range of ratios of combinations suggest that they may be useful clinically, and that the antiviral efficacy of ZDV may be increased in combination with ampligen. Synergism was also found between ampligen and zidovudine by reduction of HIV-produced plaques in a HeLa cell line expressing CD-4 receptors. However the combination of ampligen and dideoxyinosine against HIV in MT-2 cells was only additive and not synergistic.     

Conservative treatment of neonatal hydronephrosis.

From February 1990 to January 1991, 19 cases of hydronephrosis in children of less than one year of age were managed at Mackay Memorial Hospital. In the majority of these patients, there were evident causes such as ureteropelvic junction stenosis, ureterovesical reflux or a posterior urethral valve for which definite therapeutic measures were performed. However, some cases had no obvious origins and the hydronephrosis was speculated to be from nonobstructive or physiologic dilatation of the kidneys. The conventional tools, such as intravenous pyelogram or renal ultrasound, which comprise the mainstay of diagnosis, provide limited information on renal functional status. Recent introduction of the Tc-99m diethylene triamine penta-acetic acid (DTPA) diuretic renal scan has enabled us to distinguish between obstructive and nonobstructive hydronephrosis and helps us to determine whether or not surgery is necessary. In the past year, eight patients with hydronephrosis of less than one year of age were diagnosed as nonobstructive after a series of evaluations using renal ultrasound, voiding cystourethrography (VCUG) and Tc-99m DTPA diuretic renal scan. Follow-up studies by echography or DTPA renal scan revealed spontaneous resolution of the dilated collecting systems in these cases and confirms our belief that some hydronephrosis in neonates and infants may resolve spontaneously and may just be a manifestation of physiologic change during development. The value of the Tc-99m DTPA diuretic renal scan in the diagnosis of obstructive uropathy is discussed.     

Randomized placebo-controlled trial comparing montelukast and cetirizine for treating perennial allergic rhinitis in children aged 2–6 yr

Leukotriene receptor antagonists (LTRAs) were recently added to the method of treating allergic rhinitis (AR). However, in children under 6 yr old, there has been no study about its efficacy in treating AR. We aim to compare the clinical efficacy of montelukast, cetirizine and placebo in the treatment of children from 2 to 6 yr old with perennial allergic rhinitis (PAR), to see if there are any significant differences. Sixty children were selected and treated with montelukast, or cetirizine, or placebo once daily. The efficacy of the three agents was compared with the Pediatric Rhinoconjunctivitis Quality of Life Questionnaire (PRQLQ) and Total Symptom Score (TSS) by diary. In addition, we also examined serum IgE, serum eosinophil cationic protein (ECP), blood eosinophil counts, nasal airway resistance (NAR) and eosinophil percentage in nasal smears. The results revealed that both montelukast and cetirizine were significantly efficacious compared with placebo in NAR, eosinophil percentage in nasal smears, PRQLQ, TSS and all symptom items except nasal itching, throat itching and tearing. For nasal itching, only cetirizine was significantly efficacious. On the other hand, for night sleep quality, montelukast was significantly superior to cetirizine.     

Polymorphisms in manganese superoxide dismutase and catalase genes: functional study in Hong Kong Chinese asthma patients

BACKGROUND: Reactive oxygen species may contribute to the pathogenesis of asthma. Functional genetic polymorphisms of antioxidant enzymes, superoxide dismutase (SOD) and catalase are good candidates for asthma susceptibility. OBJECTIVE: To investigate the association of the manganese-containing form of SOD (MnSOD) gene at amino acid position 16 (Val16Ala) and catalase gene in the promoter at A-21T and C-262T polymorphisms and asthma in a Hong Kong Chinese population. METHODS: The association study was conducted in a case-control design in asthma patients (n=251) and healthy controls (n=316) by genotyping. The functional significance was assessed by determining erythrocyte SOD and catalase activity. RESULTS: The Val allele of MnSOD at Val16Ala and the A allele of catalase gene at A-21T were not different between patients and controls, while the C allele of catalase gene at C-262T was found to be significantly different between patients and controls (P=0.033). The less frequent variant of catalase gene (-262T) was found to be protective from the development of asthma in a Hong Kong Chinese non-smoking population (adjusted odds ratio=0.35, 0.15-0.85; P=0.017). Asthma patients had elevated erythrocyte SOD and catalase activities in comparison with healthy controls (P<0.01). However, their activities were not associated with different genotypes within healthy controls or asthma patients. CONCLUSION: This is the first report showing that SOD and catalase functional activities are not associated with their respective genetic polymorphisms but related to the presence of asthma in a Hong Kong Chinese population.     

Nucleotide changes around the splicing acceptor of intron 24 in the factor VIII gene and its impact on splicing.

Nucleotide 6724 of the factor VIII gene harbors a polymorphism of low frequency. A report from Taiwan claimed that 97.9% of the 83 alleles examined were of the A nucleotide at this position, which is quite different to the data from Western populations. Furthermore, this nucleotide is the start of exon 25, located in juxtaposition to the splicing acceptor of intron 24. We wonder if the nucleotide change at this location might have any effect on the splicing process of pre-mRNA. Using genomic DNA with direct sequencing of the polymerase chain reaction-amplified intron 24/exon 25 junction site, we found that 59 of the 60 patient samples were of the GTG sequence at nucleotides 6724-6726. The polymorphism is similar between populations in Taiwan and Western countries. The sequence of intron 24 around the splicing acceptor was always TCCAACTCTATTGCCCTCAG (-20 to -1), except for one hemophiliac patient who had a mutation in which the absolute consensus AG doublet of the intron 24 splicing acceptor changed to the AA dinucleotide. Owing to the mutation, exon 24 was erroneously spliced to exon 26, and exon 25 was skipped. This finding further testifies to the importance of the invariant AG dinucleotide in the example of the factor VIII gene.     

Tests for latent tuberculosis

Sir, In their article, Shankar and colleagues underline the significantburden of tuberculosis within their population and the importanceof identifying latent infection     

Accidental ingestion of Ecstasy in a toddler.

Toddlers who ingest the drug of abuse 3,4-methylenedioxymethamphetamine (MDMA; 'Ecstasy') are at particularly high risk of serious neurological and cardiovascular side effects. We report of a 20-month-old male toddler who accidentally ingested Ecstasy. He presented with fever and seizures, tachycardia, hypertension, and hyperthermia. Urine amphetamine level was 2111 ng/mL. Treatment included rapid cooling, hydration, and support measures. Vital signs were regularly monitored. His condition became stable on day 2 and urine amphetamine level returned to normal on day 3 of hospitalization. His behavior, activity, and appetite had returned to their usual levels upon follow-up at our outpatient clinic. The incidence of drug abuse with MDMA has increased dramatically over the last decade in developed countries. It can be expected that accidental Ecstasy poisoning in children will increase as well. This case illustrates the need to consider the possibility of accidental Ecstasy ingestion in the differential diagnosis of a child suffering from convulsions with fever.