In-111-labeled leukocyte scintigraphy in suspected orthopedic prosthesis infection: comparison with other imaging modalities

When infection of prosthetic orthopedic implants is suspected, optimal management requires accurate confirmation or exclusion of infection. The authors retrospectively studied 98 patients with possible infection who underwent scanning with indium-111-labeled white blood cells (WBCs) and subsequently underwent surgery within 14 days. At surgery, 50 patients had infections, as determined by means of culture or histologic results. The diagnostic accuracy of In-111 scanning was compared with that of plain radiography, arthrography, three-phase bone scanning, and various clinical and laboratory findings classically associated with infection. Positive findings on In-111 WBC scans and elevated erythrocyte sedimentation rates were found to be the most predictive variables in the diagnosis of septic prostheses (P less than or equal to .001 and P less than or equal to .002, respectively). Likelihood ratio analysis more clearly demonstrated the superiority of In-111 WBC scanning, with positive and negative scans yielding likelihood ratios of 5.0 and 0.16, respectively.     

Call for the international adoption of microbiological breakpoints for fluoroquinolones and Streptococcus pneumoniae

The use of current Clinical and Laboratory Standards Institute levofloxacin breakpoints for assessing fluoroquinolone resistance in Streptococcus pneumoniae is inadequate for detecting isolates possessing first-step parC mutations. Consequently, the risk for development of fluoroquinolone resistance is greatly underestimated. Adopting microbiological breakpoints for fluoroquinolones and S. pneumoniae, where parC mutations are rare in susceptible isolates, more accurately describes the emergence of resistance and may help to prevent a number of future fluoroquinolone treatment failures. Additionally, we propose that the use of a second fluoroquinolone marker, such as ciprofloxacin, offers the best prediction for detecting an isolate possessing a first-step parC mutation.     

Comparison of gatifloxacin and levofloxacin administered at various dosing regimens to hospitalised patients with community-acquired pneumonia: pharmacodynamic target attainment study using North American surveillance data for Streptococcus pneumoniae

This work aimed at determining the target attainment potential of gatifloxacin and levofloxacin in specific age-related patient populations such as elderly (> or =65 years) versus younger (<65 years) hospitalised patients with community-acquired pneumonia (CAP). Previously described population pharmacokinetic models of gatifloxacin and levofloxacin administration in patients with serious CAP were utilised to simulate gatifloxacin and levofloxacin pharmacokinetics. Pharmacokinetic simulations and susceptibility data for Streptococcus pneumoniae from the ongoing national surveillance study, Canadian Respiratory Organism Susceptibility Study (CROSS), were then used to produce pharmacodynamic indices of free-drug area under the curve over 24h relative to the minimum inhibitory concentration (free-drug AUC(0-24)/MIC(all)). Monte Carlo simulations were then used to analyse target attainment both of gatifloxacin and levofloxacin to achieve free-drug AUC(0-24)/MIC(all)> or =30 against S. pneumoniae in patients with CAP. Dosing regimens for gatifloxacin were 400 mg once daily (qd) administered to younger patients (<65 years) and gatifloxacin 200 mg qd to elderly patients (> or =65 years). Dosing regimens for levofloxacin were simulated as 500 mg, 750 mg and 1000 mg qd administered to elderly patients as well as younger patients. Monte Carlo simulations using gatifloxacin 400mg against S. pneumoniae yielded probabilities of achieving free-drug AUC(0-24)/MIC(all) of 30 of 96.6% for all patients, 92.3% for younger patients and 97.7% for elderly patients. When administered to elderly patients, a reduced dose of gatifloxacin 200mg qd could achieve a target attainment potential of 91.4%. Monte Carlo simulation using levofloxacin 500 mg qd yielded probabilities of achieving free-drug AUC(0-24)/MIC(all) of 30 of 92.3% for all patients, 95.7% for elderly patients compared with 72.7% for younger patients. Using levofloxacin 750 mg and 1000 mg qd had probabilities of achieving free-drug AUC(0-24)/MIC(all) of 30 of 97.0% and 98.3%, 98.1% and 99.2%, and 90.1% and 95.2% for all patients, elderly patients and younger patients, respectively. The probability of achieving free-drug AUC(0-24)/MIC(all) of 100 was low both with gatifloxacin and levofloxacin, except in the case of elderly patients receiving levofloxacin in a dose of 1000 mg qd (78.5%). We conclude that gatifloxacin and levofloxacin pharmacokinetics in elderly patients with CAP are markedly different from those of younger patients. Higher gatifloxacin/levofloxacin AUC and longer half-life (t(1/2)) values in elderly patients with CAP compared with younger patients provide better pharmacodynamic parameters (free-drug AUC(0-24)/MIC) leading to a higher probability of pharmacodynamic target attainment and improved bacteriological outcome against S. pneumoniae. Gatifloxacin 400mg qd results in a high probability of target attainment and improved bacteriological outcome against S. pneumoniae both in young and elderly CAP patients. However, gatifloxacin administered at a lowered dose of 200 mg qd in elderly patients could still be successful in producing a favourable antibacterial effect. Levofloxacin administered at a dose of 750 mg qd results in a high probability of target attainment and improved bacteriological outcome against S. pneumoniae in all patients with CAP.     

Screening of Stool Samples for Identification of Vancomycin-Resistant Enterococcus Isolates Should Include the Methyl-α-dGlucopyranoside Test To Differentiate Nonmotile Enterococcus gallinarum from E. faecium

The methyl-α-d-glucopyranoside (MDG) test has been shown to be superior to motility testing in differentiating Enterococcus faecium from E. gallinarum. In the present study, 33 vancomycin-resistant enterococcus (VRE) isolates collected as part of a stool surveillance study were compared by using motility and MDG. Motility testing identified all 33 isolates as E. faecium, whereas MDG identified 11 of the 33 isolates as nonmotile E. gallinarum. The MDG results were confirmed by sequencing the 16S rDNA V6-to-V8 region. We conclude that the MDG test is a necessary component of routine VRE screening.Enterococci have been shown to be the second most common cause of nosocomial infection in the United States (15). Enterococcus faecalis is responsible for the majority of enterococcal infections, whereas E. faecium, while responsible for significantly fewer infections, is more commonly associated with resistance to beta-lactams, fluoroquinones, and glycopeptides (9, 10) and is associated with greater morbidity and mortality (7). As the prevalence of infections caused by vancomycin-resistant enterococci (VRE) is presently low, the screening of stool for identification of colonizers in high-risk patients is the focus of several epidemiological studies (10, 13). It is critical in such screening studies to differentiate E. faecalis and E. faecium from other enterococcal species, such as E. gallinarum and E. casseliflavus, which do not normally cause human disease but commonly demonstrate intrinsic low-level glycopeptide resistance (1). Recent reports suggest that motility alone as the criterion for differentiating between E. gallinarum and E. faecium (3) is inadequate and may lead to the misidentification of isolates of nonmotile E. gallinarum as E. faecium (5).Recently, Devriese and coworkers have shown the methyl-α-d-glycopyranoside (MDG) test to be reliable and accurate in differentiating E. casseliflavus and E. gallinarum from E. faecalis and E. faecium (4). We were interested in determining the impact of the MDG test using a collection of vancomycin-resistant E. faecium isolates taken from a recent stool surveillance project (10) in which 1,500 enterococcal isolates had been identified to species level with a conventional identification algorithm, not containing MDG (8). The susceptibilities to glycopeptides vancomycin and teicoplanin and the glycopeptide resistance genotypes were also determined (6, 11).Frozen stock cultures of 33 vancomycin-resistant E. faecium isolates (MIC, 4 μg/ml) obtained in the VRE prevalence study were subcultured onto Trypticase soy–5% sheep blood agar and incubated at 37°C for 24 h for MDG testing and PCR lysate preparation. MDG testing of all VRE isolates was performed as previously described by Devriese et al. (4). Enterococcal species identification of each isolate was confirmed by sequencing the V6-to-V8 region (12) of the 16S rDNA which corresponds to bp 929 to 1369 of the Escherichia coli 16S rRNA sequence (2). The following ATCC strains were chosen for sequence determination: E. faecalis ATCC 29212, E. faecium ATCC 35667, E. gallinarum ATCC 35038, and E. casseliflavus ATCC 12755. Thirty-two enterococcal isolates from the stool surveillance project had also been sequenced to confirm the specificity and consistency of all sequences: 9 E. faecium isolates, 10 E. faecalis isolates, 5 E. casseliflavus isolates, and 8 E. gallinarum isolates. Subsequently, sequencing of the V6-V8 region of the 16S rDNAs of all 33 VRE isolates tested for MDG was performed. DNA extracts were prepared by using one or two colonies from the 24-h subcultures. DNA was isolated by using the QIAamp tissue kit (Qiagen, Santa Clarita, Calif.) in accordance with the manufacturer’s protocol. PCR amplification was performed by using universal 16S rDNA gene primers 91E(G) (5′TCAAAGGAATTGACGGGGGC) and 13B (5′AGGCCCGGGAACGTATTCAC) (14). A 50-μl PCR mixture contained 5 μl of DNA template; 5 μl of 25 mM MgCl₂–10× PCR buffer; 1.25 mM each dCTP, dGTP, dATP, and dUTP · dTTP in an 8:1 ratio; 0.5 μl of 100 mM each primer; 0.5 U of uracil DNA glycosylase (GibcoBRL, Burlington, Canada); 2.5 U of Taq DNA polymerase (Pharmacia Biotech, Baie d’Urfé, Canada); and 30 μl of sterile distilled H₂O. The PCR was performed with a Perkin-Elmer GeneAmp PCR System 9600 with cycles of 37°C for 10 min and 95°C for 10 min and 30 cycles of 95, 55, and 72°C for 1 min each and incubated at 72°C for 10 min for final extension.Sequencing reactions were performed with the ABI PRISM Dye Terminator Cycle Sequencing Ready Reaction kit (PE Applied Biosystems, Foster City, Calif.). The primer used for the sequencing reaction was 91E(G) or 13B diluted 1:100 in Tris-EDTA buffer. Cycle sequencing on the GeneAmp PCR System 9600 was performed, and sequencing analysis was performed with the PE-ABI 373 DNA sequencing system and Software 373 in accordance with the manufacturers’ instructions.The results obtained by MDG testing for all 33 VRE isolates demonstrated that 22 isolates were MDG negative, showing concordance with prior motility-based E. faecium identification. However, 11 VRE isolates tested MDG positive, indicating that they were in fact not E. faecium as originally reported but, instead, nonmotile E. gallinarum (Table ​(Table1).1). These 11 strains all possessed low-level glycopeptide resistance, with vancomycin and teicoplanin MICs of 4 to 8 μg/ml and 0.25 to 0.5 μg/ml, respectively.

TABLE 1

Comparison of MDG testing and species identification using sequencing with conventional testing of 33 VRE (E. faecium) isolates

CD28 co-stimulation stabilizes the expression of the CD40 ligand on T cells

The ligand for CD40 (CD40L) is a protein which is expressed on CD4 T cells following their activation: CD40-CD40L interactions are absolutely required for the induction of T cell-dependent antibody responses, yet little is known about the mechanisms whereby CD40L+ primary T cells activate naive B cells, since the protein is only transiently expressed and is rapidly down-regulated following T cell-B cell contact. We show here, using a variety of assays, that co- stimulation of primary murine T cells via CD3 and CD28 stabilizes the expression of the CD40L protein. Firstly, T cells stimulated in this manner express higher levels of CD40L when activated in the presence of B cells, compared to CD3-activated T cells. Secondly, the CD40L expressed on CD28-co-stimulated T cells is more resistant to B cell- induced down-regulation. Finally, CD3/CD28-preactivated, rested T cells re-express higher levels of CD40L more rapidly following re-stimulation via CD3 than T cells preactivated via CD3 alone. CD3/CD28-preactivated T cells, but not CD3-activated cells, are competent to induce DNA synthesis in naive B cells, and this requires re-stimulation via CD3 and prolonged ligation of CD40. These data therefore reinforce the concept that naive T cells need to be activated initially by cognate interaction with B7-bearing antigen-presenting cells (such as dendritic cells), before becoming competent helper effector cells capable of driving B cells into proliferation via a CD40-dependent pathway.      

Design, synthesis, and antibacterial activities of neomycin-lipid conjugates: polycationic lipids with potent gram-positive activity

Aminoglycoside antibiotics and cationic detergents constitute two classes of clinically important drugs and antiseptics. Their bacteriological and clinical efficacy, however, has decreased recently due to antibiotic resistance. We have synthesized aminoglycoside-lipid conjugates in which the aminoglycoside neomycin forms the cationic headgroup of a polycationic detergent. Our results show that neomycin-C16 and neomycin-C20 conjugates exhibit strong Gram-positive activity but reduced Gram-negative activity. The MIC of neomycin-C16 (C20) conjugates against methicillin-resistant Staphylococcus aureus (MRSA) is comparable to clinically used antiseptics.