Performance and sleepiness during a 24 h wake in constant conditions are affected by diet

This study investigated the effects of high-carbohydrate (HC) and high-fat (HF) diet on cognitive performance, and subjective and objective sleepiness. Seven male participants were kept awake for 24 h in a metabolic ward. Meals were given every 4h and cognitive performance and sleepiness ratings were assessed hourly. The Karolinska Drowsiness Test (KDT, EEG derived) was performed twice after meal. Performance in simple reaction time showed a significant interaction of diet and the post-prandial period, a slower reaction time was observed for the HC-diet 3.5 h after meal intake. Diet did not affect EEG measures but a general post-prandial increase of objective sleepiness was observed 3.5h after meal servings. The HC-diet was significantly associated with an increase of subjective sleepiness. The study demonstrated that the HC-diet caused larger oscillation in performance and increased sleepiness as compared to HF-diet throughout day and night.     

Biomechanical aspects of prosthetic treatment of structurally compromised teeth

PURPOSE: This article presents clinical guidelines for restoring structurally compromised teeth and dentitions to reduce the risk for fatigue-caused failures in connection with prosthetic reconstructions. MATERIALS AND METHODS: Based on the best scientific evidence available and clinical expertise acquired through experience and practice, biomechanical principles are elucidated from a prosthetic aspect. RESULTS: In prosthetic treatment in the structurally compromised dentition, all efforts need to be focused on protecting the abutments and reconstruction from future fatigue failures. A modified, "therapeutic" occlusion to avoid nonaxial forces may then be prudent. CONCLUSION: By lending the prosthesis a favorable occlusal design, the nonaxial forces may be markedly reduced, and the teeth, cement, and restorative materials will be less susceptible to fatigue failures.     

Novel insertion and deletion mutations in the 5'-UTR of the folate receptor-alpha gene: an additional contributor to hyperhomocysteinemia?

OBJECTIVES: To search for mutations in the 5'-UTR and proximal promoter region of the folate receptor-alpha (FR-alpha) gene, whose exons are known to be virtually free of genetic variation in the population. DESIGN AND METHOD: Seven hundred seventy-eight patient samples were screened for mutations between nt -116 and nt +207 in the FR-alpha gene using single strand conformation polymorphism (SSCP) followed by DNA sequencing. RESULTS: Three patients were found to have a 25-bp deletion, c.109_133delCCACTAAACCACAGCTGTCCCCTGG, and three others had a 1-bp A insertion, c.-69dupA, so that 0.77% of the patient population showed genetic variation already in the 323 bp promoter sequence studied so far. CONCLUSIONS: The promoter region of FR-alpha may harbor much more genetic variation than its highly conserved exons, and not just isolated, unique mutations. This could be a new factor contributing to gene-food interaction explaining part of the hyperhomocysteinemia panorama. Extended searches for polymorphisms further upstream in the FR-alpha gene are warranted.     

Swedish mental health nurses' responsibility in supervised community care of persons with long-term mental illness

The aim of the present study was to describe psychiatric nurses' experience of how the changing focus of mental health care in Sweden, from in-patient treatment to community-based care, has influenced their professional autonomy. Eleven psychiatric nurses were interviewed and a qualitative content analysis was used to identify major themes in the data. Three main themes were found: pattern of responsibility, pattern of clinical judgement, and pattern of control through support and supervision. All themes were related to the nurse's identity, moral responsibility and the feelings of loneliness and independence in his/her daily work. Together, the three themes were found to constitute a process. This study shows the complexity involved in nursing care provided in the patient's home. Achieving control over the patient's everyday life through support and supervision does not imply taking over the patient's autonomy, but rather reducing the stigma attached to mental illness and facilitating the process of rehabilitation.     

Drug selection for the newly diagnosed patient: When is a new generation antiepileptic drug indicated?

Abstract. Treatment options in epilepsy have increased dramatically since the early 1990s with the introduction of nine new generation antiepileptic drugs (AEDs) (felbamate, gabapentin, lamotrigine, levetiracetam, oxcarbazepine, tiagabine, topiramate, vigabatrin and zonisamide). This makes drug selection much more complicated and challenging. This review discusses drug selection in patients with newly diagnosed epilepsy and in particular the role of new AEDs in this population. The choice of treatment should always be based on a careful comparison of the risk-benefit ratio for the different treatment options and the outcome of such evaluation may be different in patients with new onset compared with chronic epilepsy. Efficacy, tolerability and safety are the main criteria for selection of AEDs and any first line drug for patients with newly diagnosed epilepsy must have demonstrated satisfactory efficacy as monotherapy in that patient population. So far, of the new AEDs only lamotrigine, oxcarbazepine and topiramate have documentation sufficient to be granted licence for use as monotherapy in most European countries. Because the new generation AEDs have failed to demonstrate improved effectiveness as monotherapy, old generation AEDs such as carbamazepine and valproate remain drugs of first choice for partial and generalised seizures, respectively. However, there are special situations and populations where a new AED may be a reasonable first line drug. These include vigabatrin in West syndrome associated with tuberous sclerosis, lamotrigine as alternative to valproate in idiopathic generalised seizures in women of childbearing potential and lamotrigine for the treatment of epilepsy in the elderly population. The role of the new generation AEDs is likely to become more prominent as more experience is gained.     

Comparison of plasma levels of cytokines and in vitro generation of reactive oxygen species after nicotine infusion in nicotine users with normal and impaired renal function

Several in vitro and animal studies suggest effects of nicotine on the immune system, but little evidence exists regarding the in vivo immunomodulation of nicotine in humans. The increased use of nicotine replacement therapy to aid smoking cessation claims further understanding of how nicotine affects blood leukocytes. This is of particular importance when nicotine therapy is used in diseases associated with alterations of the immune system, such as chronic renal failure. The present study evaluates the acute effects of nicotine infusion (NI) on some immunoregulatory functions in seven healthy subjects and seven patients with renal failure. All subjects were nicotine users and had refrained from using nicotine for 36 h before NI. Blood was collected before, immediately after, and 2 h after NI. Plasma concentrations of intercellular adhesion molecule-1 (ICAM-1) and the cytokines interleukin-2 (IL-2), IL-4, IL-10, interferon-gamma and RANTES were measured using specific immunoassays. The generation of reactive oxygen species (ROS) induced by formyl-methionyl-leucyl-phenylalanine (fMLP), Ristocetin, adenosine 5'-diphosphate, or collagen was registered in whole blood as luminol-dependent chemiluminescence. Except for fMLP, these compounds induce leukocyte ROS generation by platelet mediated mechanisms. NI did not significantly affect the levels of the cytokines and ICAM-1 in any group. The peak and the persistent ROS production, induced by collagen and Ristocetin, was lower at some time points in patients with renal failure as compared to healthy subjects. Also in patients with renal failure, both peak height and persistent ROS generation induced by Ristocetin were reduced immediately after NI. Thus, nicotine inhibits some of the platelet-mediated activation of leukocyte ROS generation, and may be associated with platelet defects in renal failure.