Prostaglandin E1 and dibutyryl cyclic AMP enhance platelet resistance to deformation

The effect of prostaglandin E₁ (PGE₁) on platelets is mediated through the PGE₁ receptor and the consequent maintenance of the platelet's discoid shape. The effects of PGE₁ and dibutyryl cAMP (dbcAMP) on the deformability of human platelets were studied. Deformability tests based upon the micropipette aspiration on the platelets were performed by using pipettes with radii (Rp) of 0.26-0.36 gm. The time course of the extension length (Dp, in μg) of the platelets in response to aspiration with a negative pressure (ΔP) of 5 cm H₂ O (ΔP × Rp = 0.15 dynes/cm) was analyzed. PGE₁ treatment (0.1 μM) resulted in a decrease of platelet deformability as compared with results obtained for apparently non-activated, control platelets. The deformation index, i.e., Dp/Rp (PGE₁ -treated) / Dp/Rp (control), was significantly reduced to 0.90 ± 0.04. DbcAMP treatment also significantly decreased the deformability of platelets and this decrease was dbcAMP dose dependent. In contrast, colchicine- or cytochalasin D-treated platelets increased deformability. PGE₁ -treated platelets had a higher [cAMP]_i than controls. Platelets treated with PGE₁ or dbcAMP showed a reduced [Ca²⁺]i increment induced by thrombin as compared to non-treated controls. These results indicate that PGE₁ and dbcAMP treatment of platelets is accompanied by an enhancement of platelet resistance to deformation. The increased [cAMP]_i and low [Ca²⁺]_i after PGE₁ treatment may limit the rearrangement of cytoskeleton and thus enhance platelet resistance to deformation.     

Hormone replacement therapy is associated with increased C-reactive protein in women with Type 2 diabetes in the Diabetes Heart Study.

AIMS: Increased levels of inflammatory biomarkers, especially C-reactive protein (CRP), are associated with increased risk for cardiovascular disease (CVD) events, such as myocardial infarction, stroke, peripheral vascular disease, and sudden cardiac death. Medical interventions that increase CRP levels, such as hormone replacement therapy (HRT) in post-menopausal women, are under increasing scrutiny. The effect of HRT on CRP levels in women with Type 2 diabetes (T2DM) is not well documented, and conflicting conclusions have been reported. The aim of this study was to determine the influence of HRT on women with diabetes in a large cross-sectional study. METHODS: Three hundred and twenty-seven post-menopausal women with T2DM from the Diabetes Heart Study participated. Current use of HRT was determined and serum CRP levels were measured using a high-sensitivity ELISA kit. Generalized estimating equation methods were used to assess the relationship of multiple clinical and lifestyle (e.g. smoking) measures on CRP levels including differences between women taking HRT (HRT+) and not taking HRT (HRT-). RESULTS: Overall serum CRP levels were strongly associated with body mass index (P < 0.0001) and age (P < 0.0001). Of the women, 243 were not using HRT and 84 were using HRT. HRT+ and HRT- women did not differ significantly in measures of clinical traits, with the exception of higher mean low-density lipoprotein cholesterol in HRT- women (P = 0.004). In all models tested, HRT+ women had significantly higher circulating CRP levels, with P-values ranging from 0.0045 to 0.010. CONCLUSIONS: In this study of serum CRP concentration as a function of HRT in women with Type 2 diabetes, there was consistent evidence for increased circulating CRP levels in women receiving oestrogen-containing HRT. Whether HRT-induced increases in CRP can account for the adverse cardiovascular effects of HRT remains to be established; however, based on these data, there is little reason to believe that diabetic women would be spared from such an effect.     

Nucleotide changes around the splicing acceptor of intron 24 in the factor VIII gene and its impact on splicing.

Nucleotide 6724 of the factor VIII gene harbors a polymorphism of low frequency. A report from Taiwan claimed that 97.9% of the 83 alleles examined were of the A nucleotide at this position, which is quite different to the data from Western populations. Furthermore, this nucleotide is the start of exon 25, located in juxtaposition to the splicing acceptor of intron 24. We wonder if the nucleotide change at this location might have any effect on the splicing process of pre-mRNA. Using genomic DNA with direct sequencing of the polymerase chain reaction-amplified intron 24/exon 25 junction site, we found that 59 of the 60 patient samples were of the GTG sequence at nucleotides 6724-6726. The polymorphism is similar between populations in Taiwan and Western countries. The sequence of intron 24 around the splicing acceptor was always TCCAACTCTATTGCCCTCAG (-20 to -1), except for one hemophiliac patient who had a mutation in which the absolute consensus AG doublet of the intron 24 splicing acceptor changed to the AA dinucleotide. Owing to the mutation, exon 24 was erroneously spliced to exon 26, and exon 25 was skipped. This finding further testifies to the importance of the invariant AG dinucleotide in the example of the factor VIII gene.     

Sonography of a human jackstone calculus.

Jackstone calculi are urinary tract stones that have a specific appearance resembling toy jacks. They are almost always composed of calcium oxalate dihydrate and may be found in the urinary bladder or rarely in the upper urinary tract. Their appearance on plain radiographs and computed tomography (CT) in human patients has been well described. They have also been imaged in several species of animals. However, our review of the English medical literature revealed no previous report in which a jackstone calculus had been identified on the sonographic examination of a human patient. We report a case in which a large jackstone calculus was incidentally detected during abdominal sonography in a 75-year-old man.     

Immunohistochemical study of lymph nodes in patients with cat scratch disease.

BACKGROUND/PURPOSE: Bartonella henselaeis the causative agent of cat scratch disease (CSD), manifesting as fever and acute regional lymphadenopathy. Although serologic testing is the reference method for diagnosis, successful use of immunohistochemical (IHC) stain of regional lymph nodes for the diagnosis of CSD has been reported. To determine the characterization and diagnostic potential of IHC in lymphadenopathy of CSD, lymph nodes were excised from patients with suspected CSD for further evaluation. METHODS: Polyclonal antibody-based IHC studies were performed for the detection of B. henselae. Between January 2001 and December 2004, the reference laboratory of the Center for Disease Control, Taiwan, received a total of 377 sera from 352 reported suspected CSD cases. Twenty-three formalin-fixed paraffin-embedded lymph nodes from 16 patients and two skin biopsies from two patients suspected of having CSD were included in this study. Nine of them were serologically confirmed to have CSD and the others were seronegative but suspected to have CSD by the attending physicians. Seven lymph node specimens were obtained from tuberculosis patients for comparison. RESULTS: We demonstrated that the microorganisms existed in the cytoplasm of histiocytes within the granulomatous lesions in nine lymph nodes and one skin biopsy. Among the nine lymph nodes with IHC (+) stains, three were seronegative. On the other hand, three cases were IHC (+) and six cases were IHC (-) among nine seronegative patients. In addition, two seronegative patients with skin biopsy showed one IHC (+) and one IHC (-). CONCLUSION: IHC can contribute to the etiologic diagnosis of B. henselaelymphadenopathy when serology and molecular techniques are not available.     

Dynamic evaluation of 18F-FDG uptake by microPET and whole-body autoradiography in a fibrosarcoma-bearing mouse model.

BACKGROUND AND PURPOSE: Fluorine-18-2-deoxy-D-glucose (18F-FDG) has been used in the clinic as a diagnostic radiotracer for monitoring many kinds of tumors, but its value for monitoring fibrosarcoma is not well established. METHODS: In this study, the uptake of 18F-FDG in a fibrosarcoma-bearing mouse model was evaluated using the high resolution positron emission tomography (PET) system microPET. Tumor cells were implanted in 3 FVB/N mice, and static microPET scanning was performed on day 1, 7, 12 and 15 after implantation. A dynamic microPET image was scanned on day 12 to determine the 18F-FDG uptake in 3 other tumor-bearing mice. Time-activity curves were plotted by drawing regions of interest in the tumor, liver, kidneys and muscles. The mice were sacrificed after dynamic microPET imaging and whole-body autoradiography (WBAR) was performed. For biodistribution study, 9 tumor-bearing mice, 3 per experimental group, were studied at 3 time points and the results were compared with the static microPET images. RESULTS: MicroPET images suggested that 18F-FDG could be used to monitor the growth of tumors 7 days after implantation. Dynamic scans of 18F-FDG uptake reached a plateau in the tumor after 20 minutes on day 12 after implantation. Both microPET and WBAR revealed evidence of tumor necrosis. The results of biodistribution and WBAR agreed with those from microPET images. CONCLUSION: MicroPET was useful for monitoring the growth of fibrosarcoma and determination of the maximal uptake time point of 18F-FDG in tumors in this tumor-bearing mouse model.     

Prognostic role of alveolar-arterial oxygen pressure difference in acute pulmonary embolism.

BACKGROUND: This study investigated the utility of the alveolar - arterial oxygen pressure difference (AaDO (2)) in predicting the short-term prognosis of acute pulmonary embolism (PE). METHODS AND RESULTS: This study retrospectively enrolled 114 consecutive patients with acute PE, diagnosed by either spiral computed tomography or high probability ventilation - perfusion lung scans. During the first 24 h of admission, all patients had initial artery blood gas collected under room air. Patient exclusion criteria were chronic lung disease, septic emboli, and moderate and low probability lung scans. Patients were assigned to 2 groups based on either 30-day death or a 30-day composite event. Receiver operating characteristic analyses was used to determine the AaDO(2) cut-off value for predicting primary and composite endpoints. Statistical analysis demonstrated significant differences in AaDO(2) between the 30-day composite endpoint group and the 30-day composite event-free survival group (p=0.012). The AaDO(2) had a strong trend between the 30-day death group and the survival group (p=0.062). The best cut-off value for AaDO(2) was 53 mmHg and using this, the positive predictive value for 30-day death was 25% and the negative predictive value was 92%. For the 30-day composite endpoint, the positive predictive value for AaDO(2) was 35%, and the negative predictive value was 84%. In this study, thrombocytopenia was also an indicator of poor prognosis for patients with acute PE. CONCLUSION: The AaDO(2) measurement is a highly useful and simple measurement for predicting short-term prognosis in patients with acute PE. It has high negative predictive value and moderate positive predictive value for 30-day death and 30-day composite event. Aggressive thrombolytic treatment strategies should be considered for patients with an initial poor prognostic parameter (ie, AaDO(2) >or=53 mmHg).     

The effects of hyperthyroidism on oesophageal motility.

This study, evaluating the effects of hyperthyroidism (HT) in oesophageal motility, depended on an oesophageal radionuclide transit test. A modified standard method was used to calculate: (a) total mean transit time (MTT), (b) residual fraction (RF) and (c) retrograde index (RI) in a supine position. Eighteen untreated patients with HT and 25 normal volunteers (NV) with a similar age distribution were included in this study. The results showed that oesophageal motility in patients with HT was worse than in the normal controls (P < 0.05 by Student's t-test). The correlation of MTT, RF and RI with size and function of thyroid glands in the patients with HT were calculated to explain the effects of HT in oesophageal motility. The results showed that neither the size nor the function of the thyroid glands in HT affected oesophageal motility.     

Nitric oxide production and immunoglobulin deposition in leptospiral hemorrhagic respiratory failure.

Diffuse pulmonary hemorrhage leading to death is a syndrome which may develop in leptospirosis, but its pathophysiology is not well documented. We report an autopsy case of leptospirosis. A healthy 41-year-old man presented with low back myalgia, dry cough and fever for 4 days and a normal chest X-ray on admission. Acute respiratory failure developed hours later. Profuse bloody fluid appeared in the endotracheal tube immediately after intubation. Chest X-ray showed whiteness across all lung fields. He died of persistent shock 16 h after the onset of acute respiratory failure. Autopsy revealed diffuse pulmonary hemorrhage with hyaline-membrane formation, myocarditis, interstitial nephritis and hepatitis. Silver stain of lung and kidney tissue demonstrated leptospires. Immunohistochemical staining showed inducible nitric oxide synthase in alveolar macrophages. Immunofluorescein staining showed immunoglobulin in alveolar septum and alveolar space. This case suggests that hemorrhagic diffuse alveolar damage with persistent shock is related to over-production of nitric oxide and immunoglobulin deposition in fatal leptospirosis.     

A Bayesian iterative transmission gradient reconstruction algorithm for cardiac SPECT attenuation correction

Background  High-quality attenuation maps are critical for attenuation correction of myocardial perfusion single photon emission computed tomography studies. The filtered backprojection (FBP) approach can introduce errors, especially with low-count transmission data. We present a new method for attenuation map reconstruction and examine its performance in phantom and patient data. Methods and Results  The Bayesian iterative transmission gradient algorithm incorporates a spatially varying gamma prior function that preferentially weights estimated attenuation coefficients toward the soft-tissue value while allowing data-driven solutions for lung and bone regions. The performance with attenuation-corrected technetium 99m sestamibi clinical images was evaluated in phantom studies and in 50 low-likelihood patients grouped by body mass index (BMI). The algorithm converged in 15 iterations in the phantom studies. For the clinical studies, soft-tissue estimates had significantly greater uniformity of mediastinal coefficients (mean SD, 0.005 cm⁻¹ vs 0.011 cm⁻¹; P<.0001). The accuracy and uniformity of the Bayesian iterative transmission gradient algorithm were independent of BMI, whereas both declined at higher BMI values with FBP. Attenuation-corrected perfusion images showed improvement in myocardial wall variability (4.8% to 4.1%, P=.02) for all BMI groups with the new method compared with FBP. Conclusion  This new method for attenuation map reconstruction provides rapidly converging and accurate attenuation maps over a wide spectrum of patient BMI values and significantly improves attenuation-corrected perfusion images.