Molecular characterisation and polymorphism of MinLm1, a minisatellite from the phytopathogenic ascomycete Leptosphaeria maculans

A sequence-characterised amplified region marker was identified in the phytopathogenic fungus Leptosphaeria maculans, which generated a single-banding pattern corresponding to six alleles showing size polymorphism between L. maculans field isolates. The size polymorphism was due to 2-7 tandem repeats of the 23-bp motif 5' TCTTACTTACATACACACCTCCC 3'. The repeated sequence, termed MinLm1, shares many features specific to minisatellites, e.g. a very strong G/C strand asymmetry, the presence of 6-bp direct repeats at both ends of the sequence and its occurrence in a region rich in microsatellites such as (CT)n, (ATG)n, (GTG)n and (CAT)n. MinLm1 shows a very high degree of conservation of the bases from one repeat to another and from one isolate to another (percent match range: 99.6-100%), whatever their geographical or temporal relatedness. MinLm1 is a single-locus minisatellite located on chromosomes sized 2.79 Mb and 2.48 Mb, of L. maculans isolates a.2 and H5, respectively. In agricultural populations of L. maculans, two alleles of MinLm1 were prevalent, corresponding to 2x and 5x repeats of the core motif. Differences in allele frequencies were observed in some cropping conditions, suggesting that MinLm1 is an informative marker for epidemiological studies of the pathogen.     

Microangiopathy of the inner ear, retina, and brain (Susac syndrome): report of a case

Microangiopathy of the inner ear, retina, and brain was first described in 1979 by John O. Susac. Since then, approximately 60 cases have been reported. Otolaryngologists must be aware of this syndrome, in which cochleovestibular symptoms are an important part of the diagnosis. In this article, we report a new case of Susac syndrome and discuss the diagnosis, physiopathologic characteristics, and treatment of this disease.     

Intracerebral transplantation of oligodendrocytes in mice

We describe in this paper experiments in which oligodendrocytes (from newborn mouse, human embryonic brain, or isolated from adult rat brain) have been transplanted into the brain of the newborn mouse. Experimental conditions (Shiverer model) allowed the detection of myelin formed by transplanted oligodendrocytes into the Shiverer brain. The transplanted oligodendrocytes have been shown to survive, migrate over long distances and myelinate host axons. The maturation of transplanted oligodendrocytes depends upon the age of the brain tissue in which they differentiate.     

Production and characterization of a monoclonal antibody reactive with a specific neoantigenic determinant (comprising B beta 54-118) in degradation products of fibrin and of fibrinogen

Balb/c mice were immunized with a mixture of fibrin degradation products (XDPs) prepared by complete lysis of a human blood clot by tissue-type plasminogen activator and purified by immunoaffinity chromatography. Spleen cells of the mice were fused with P3 X 63 Ag 8653 myeloma cells. A clone (FDP 14) was selected that produces monoclonal antibodies (MoAbs) of the IgG1 kappa type that react with a neoantigenic determinant exposed in these XDPs, but not in intact fibrinogen or in fibrin monomers. Furthermore, the MoAb is reactive with some pure, individual degradation products of fibrinogen (fragments X, Y, E, and the N-terminal disulphide knot) and with the fibrinogen B beta-chain but not with A alpha- and gamma-chains or with fragments D, FCB-2 and FCB-3. Comparison of the known primary structures of these fibrinogen fragments indicates that the stretch B beta 54-118 comprises at least an important part of the epitope recognized by FDP-14. Apparently, this stretch contributes importantly to a neoantigenic determinant that is not functional in intact fibrinogen and fibrin monomer and that can be made functional by reduction of fibrinogen, or by digestion with plasmin or CNBr.     

Spondylometaphyseal dysplasia, corner fracture type: a heritable condition associated with coxa vara

The authors present the radiographic features of a previously incompletely delineated bone dysplasia, which they call spondylometaphyseal dysplasia, corner fracture type. This is a dominant heritable condition associated with short stature and developmental coxa vara. The progressive hip deformity usually causes significant disability requiring surgical correction. Developmental coxa vara, simulated corner fractures of long tubular bones, and vertebral body abnormalities result in a diagnostic constellation. Knowledge of these distinctive radiologic features allows accurate diagnosis, which in turn should lead to appropriate genetic counseling and possibly to earlier, more efficacious surgical treatment of the coxa vara.     

Chronic myelopathies associated with human T-lymphotropic virus type I. A clinical, serologic, and immunovirologic study of ten patients in France

Chronic myelopathy associated with human T-lymphotropic virus type I (HTLV-I) has been described in HTLV-I endemic areas. In Paris, 167 neurologic patients were screened for HTLV-I by enzyme-linked immunosorbent, indirect immunofluorescent, and Western blot assays. Ten of the 11 patients with positive results had a chronic spastic paraparesis with IgG oligoclonal bands and elevated HTLV-I antibody index. Two of them had been born and were living in France, without HTLV-I risk factors. Evoked potentials were abnormal in the nine tested patients and brain magnetic resonance images in three of seven patients. No improvement was observed with steroid treatment. A retrovirus similar to HTLV-I was isolated in five cases at different periods of the disease. Hypotheses of limited endemic areas in western countries are discussed. Early presence and persistence of HTLV-I suggest that it is the etiologic agent.     

Effacement of the fetal cisterna magna in association with myelomeningocele

The cisterna magna is effaced in association with myelomeningocele. The authors retrospectively investigated the size of the fetal cisterna magna as a predictor of fetal myelomeningocele in 67 pregnant women (17-38 menstrual weeks) referred for prenatal sonography because of an elevated serum alpha-fetoprotein level (n = 61) or a suspicion of fetal ventriculomegaly on previously obtained sonograms (n = 6). Twenty fetuses had myelomeningocele, 14 had isolated ventriculomegaly, and 33 were normal. A normal-sized cisterna magna (range, 4-9 mm in depth) was present in all normal fetuses. In 19 of 20 fetuses with myelomeningocele, the views of the posterior fossa were adequate, and in each of these the cisterna magna was effaced (n = 18) or very small (n = 1). The cisterna magna was effaced in five of 13 (38%) fetuses with isolated ventriculomegaly in whom the posterior fossa was adequately imaged. Although effacement of the cisterna magna is a nonspecific finding, the high negative predictive value of this sign is useful during routine screening of the fetal neural axis.