Four novel mutations in the gene encoding gp91-phox of human NADPH oxidase: consequences for oxidase assembly

The superoxide-forming nicotinamide adenine dinucleotide phosphate reduced (NADPH) oxidase of human phagocytes comprises membrane-bound and cytosolic proteins, which, upon cell activation, assemble on the plasma membrane to form the active enzyme. Patients with chronic granulomatous disease (CGD) are defective in one of the phagocyte oxidase (phox) components, p47-phox or p67-phox, which reside in the cytosol of resting phagocytes, or gp91-phox or p22-phox, which constitute the membrane-bound cytochrome b(558). In four X-linked CGD patients we have identified novel missense mutations in CYBB, the gene encoding gp91-phox. These mutations were associated with normal amounts of nonfunctional cytochrome b(558) in the patients' neutrophils. In phorbol-myristate-stimulated neutrophils and in a cell-free translocation assay with neutrophil membranes and cytosol, the association of p47-phox and p67-phox with the membrane fraction of the cells with Cys369-->Arg, Gly408-->Glu, and Glu568--> Lys substitutions was strongly disturbed. Only a Thr341-->Lys substitution, residing in a region of gp91-phox involved in flavin adenine dinucleotide (FAD) binding, supported a normal translocation. Thus, the introduction or reversal of charge at residues 369, 408, and 568 in gp91-phox destroys the correct binding of p47-phox and p67-phox to cytochrome b(558). Based on mutagenesis studies of structurally related flavin-dependent oxidoreductases, we propose that the Thr341-->Lys substitution results in impaired hydride transfer from NADPH to FAD. Because we found no electron transfer in solubilized neutrophil plasma membranes from any of the four patients, we conclude that all four amino acid replacements are critical for electron transfer. Apparently, an intimate relation exists between domains of gp91-phox involved in electron transfer and in p47/p67-phox binding. (Blood. 2000;95:666-673)     

Involvement of Caspases in Neutrophil Apoptosis: Regulation by Reactive Oxygen Species

Human neutrophils have a short half-life and are believed to die byapoptosis or programmed cell death both in vivo and in vitro. We foundthat caspases are activated in a time-dependent manner in neutrophilsundergoing spontaneous apoptosis, concomitant with other characteristicfeatures of apoptotic cell death such as morphologic changes,phosphatidylserine (PS) exposure, and DNA fragmentation. The treatmentof neutrophils with agonistic anti-Fas monoclonal antibodies (MoAbs)significantly accelerated this process. However, in cells treated withthe potent neutrophil activator phorbol 12-myristate 13-acetate (PMA),caspase activity was only evident after pharmacologic inhibition of thenicotinamide adenine dinucleotide phosphate (NADPH)oxidase. Similarily, inhibition of the NADPH oxidase in constitutiveand Fas/APO-1-triggered apoptosis resulted in increased rather thansuppressed levels of caspase activity, suggesting that reactive oxygenspecies may prevent caspases from functioning optimally in these cells.Moreover, oxidants generated via the NADPH oxidase were essential forPS exposure during PMA-induced cell death, but not for neutrophils undergoing spontaneous apoptosis. We conclude that caspases are animportant component of constitutive and Fas/APO-1-triggered neutrophilapoptosis. However, these redox sensitive enzymes are suppressed inactivated neutrophils, and an alternate oxidant-dependent pathway isused to mediate PS exposure and neutrophil clearance under theseconditions.     

Chronic granulomatous disease caused by mutations other than the common GT deletion in NCF1, the gene encoding the p47phox component of the phagocyte NADPH oxidase

Chronic granulomatous disease (CGD) is an inherited immunodeficiency caused by defects in any of four genes encoding components of the leukocyte nicotinamide dinucleotide phosphate, reduced (NADPH) oxidase. One of these is the autosomal neutrophil cytosolic factor 1 (NCF1) gene encoding the p47phox protein. Most (>97%) CGD patients without p47phox (A47 degrees CGD) are homozygotes for one particular mutation in NCF1, a GT deletion in exon 2. This is due to recombination events between NCF1 and its two pseudogenes (psiNCF1) that contain this GT deletion. We have previously set up a gene-scan method to establish the ratio of NCF1 genes and pseudogenes. With this method we now found, in three CGD families patients with the normal number of two intact NCF1 genes (and four psiNCF1 genes) and in six CGD families, patients with one intact NCF1 gene (and five psiNCF1 genes). All patients lacked p47phox protein expression. These results indicate that other mutations were present in their NCF1 gene than the GT deletion. To identify these mutations, we designed PCR primers to specifically amplify the cDNA or parts of the genomic DNA from NCF1 but not from the psiNCF1 genes. We found point mutations in NCF1 in eight families. In another family, we found a 2,860-bp deletion starting in intron 2 and ending in intron 5. In six families the patients were compound heterozygotes for the GT deletion and one of these other mutations; in two families the patients had a homozygous missense mutation; and in one family the patient was a compound heterozygote for a splice defect and a nonsense mutation. Family members with either the GT deletion or one of these other mutations were identified as carriers. This knowledge was used in one of the families for prenatal diagnosis.     

Haemophilus influenzae resides and multiplies intracellularly in human adenoid tissue as demonstrated by in situ hybridization and bacterial viability assay.

The DNA oligomer 5'-d(TGCGGCCTCTCAGTCCCGCACTTTCATCTTCC)-3' specifically recognizes Haemophilus influenzae 16S rRNA. We report here the use of this oligonucleotide, with a fluorescein label tagged on its 5' end, as a probe for the in situ detection of nonencapsulated nontypeable H. influenzae in sections of adenoid tissue from 10 children who were clinically infection free but were having their adenoids removed because of nasal obstruction. In some cases, the reticular crypt epithelium was focally infiltrated by H. influenzae. The reservoir for these bacterial colonizations, in all likelihood long standing, seemed to be macrophage-like cells found in the subepithelial layers in all 10 cases. These mononuclear cells contained up to 200 intracellular H. influenzae cells. In the transmission electron macroscope, macrophage-like cells with intracellular bacteria with coccoid morphology, at least some of which were dividing, were seen. Adenoid cell suspensions, enriched for macrophages by use of paramagnetic beads coated with monoclonal antibodies against the CD14 marker, yielded up to 1,100 CFU of nontypeable H. influenzae per 10(5) cells after killing of extracellular bacteria with gentamicin followed by mechanical lysis of the cells.     

Influence of storing urogenital specimens at -20 degrees C before testing by enzyme amplified immunoassay (IDEIA) to detect Chlamydia trachomatis antigen.

Urogenital specimens from 445 patients, 174 women and 271 men, were tested for antigen to Chlamydia trachomatis by an enzyme amplified immunoassay, IDEIA. The test results for specimens stored at -20 degrees C for means of 9.6 weeks (from each of the first 376 patients) and eight months (from the remaining 69) were compared with results for specimens stored at 4 degrees C and tested within five days. Of 617 specimens (one from the urethra of each patient and one from the cervices of 172 women) cultured for C trachomatis, 90 (15%) gave positive results. The IDEIA results for specimens stored at -20 degrees C were identical with those of specimens analysed without such storage in 96.4% (595/617) of all cases. No difference was seen between urethral specimens from men or women or cervical specimens or between specimens stored for 9.6 weeks compared with those stored for eight months. In 22 cases in which the IDEIA results differed, culture positive results were missed in stored as well as unstored specimens. The median absorbance value above the cut off point for a positive IDEIA result in stored specimens was no lower than in those not stored. The few differences noted probably depended on the sampling technique rather than on the way of storing the specimens.