Prostaglandin E1 and dibutyryl cyclic AMP enhance platelet resistance to deformation

The effect of prostaglandin E₁ (PGE₁) on platelets is mediated through the PGE₁ receptor and the consequent maintenance of the platelet's discoid shape. The effects of PGE₁ and dibutyryl cAMP (dbcAMP) on the deformability of human platelets were studied. Deformability tests based upon the micropipette aspiration on the platelets were performed by using pipettes with radii (Rp) of 0.26-0.36 gm. The time course of the extension length (Dp, in μg) of the platelets in response to aspiration with a negative pressure (ΔP) of 5 cm H₂ O (ΔP × Rp = 0.15 dynes/cm) was analyzed. PGE₁ treatment (0.1 μM) resulted in a decrease of platelet deformability as compared with results obtained for apparently non-activated, control platelets. The deformation index, i.e., Dp/Rp (PGE₁ -treated) / Dp/Rp (control), was significantly reduced to 0.90 ± 0.04. DbcAMP treatment also significantly decreased the deformability of platelets and this decrease was dbcAMP dose dependent. In contrast, colchicine- or cytochalasin D-treated platelets increased deformability. PGE₁ -treated platelets had a higher [cAMP]_i than controls. Platelets treated with PGE₁ or dbcAMP showed a reduced [Ca²⁺]i increment induced by thrombin as compared to non-treated controls. These results indicate that PGE₁ and dbcAMP treatment of platelets is accompanied by an enhancement of platelet resistance to deformation. The increased [cAMP]_i and low [Ca²⁺]_i after PGE₁ treatment may limit the rearrangement of cytoskeleton and thus enhance platelet resistance to deformation.     

Surgical Management of Marfan Syndrome in Children

Between August 1983 and January 1991, seven patients with Marfan syndrome underwent surgery for severe cardiovascular complications. The mean age at presentation was 5.7 months (range 4 to 9 months) in the infant group (n = 3), and 13.3 years (range 10 to 16 years) in a group of older children (n = 4). The primary indications for surgery in the infant group (performed at a mean of 3 years after diagnosis) were ascending aortic aneurysm with valvar regurgitation in one patient, and severe mitral valve prolapse with regurgitation in two. In the older group, surgical indications (performed at a mean of 2.8 years after diagnosis) were ascending aortic aneurysm with valvar regurgitation in three patients and acute aortic dissection in one. For aortic surgery, a composite valved conduit was used in four patients, and an aortic homograft in one. For mitral valve surgery, mechanical prostheses were used. Ail patients survived the primary operation. Over a mean follow-up of 17.5 patient-years (range 1 to 9 years), two patients in the infant Marfan group went on to further successful surgery (prosthetic mitral valve replacement and aortic root repair with aortic homograft) at a mean interval of 4.3 years after the Initial surgery. Our results suggest that the major cardiovascular risk factors of Marfan syndrome in the young, even in those diagnosed during infancy, have been favorably changed by surgery with an encouraging medium-term outlook. The correct timing of surgery is aided by echocardiography. (J Card Surg 1994;9:50–54)     

Effects of preparation techniques on the porosity of acrylic cements

We investigated four acrylic cement preparation techniques for their effects on cement porosity: hand mixing, pressurization in a pneumatic pistol, centrifugation, and vacuum mixing. All the techniques were tested on three types of cement with different viscosity characteristics. The best results were obtained with vacuum mixing using a newly designed experimental system, yielding porosity reductions of 60-80 percent relative to hand mixing. Vacuum mixing with a commercial system was also effective, but to a somewhat lesser extent.

Pressurization and centrifugation had no substantial effect on the overall porosity. Centrifugation led to considerable nonuniformity in the distribution of pores and additives.     

Short utterance recognition using a network with minimum training

A feedforward network is used to recognize short, digitized, isolated utterances. A high, multispeaker recognition rate is achieved with a small vocabulary with a single training utterance. This approach makes use of the pattern recognition property of the network architecture to classify different temporal patterns in the multidimensional feature space. The network recognizes the utterances without the need of segmentation, phoneme identification, or time alignment. We train the network with four words spoken by one single speaker. The network is then able to recognize 20 tokens spoken by 5 other speakers. We repeat the above training and testing procedure using a different speaker's utterances for training each time. The overall accuracy is 97.5%. We compare this approach to the traditional dynamic programming (DP) approach, and find that DP with slope constraints of 0 and 1 achieve 98.5% and 85% accuracies respectively. Finally we validate out statistics by training and testing the network of a four-word subset of the Texas Instruments (Tl) isolated word database. The accuracy with this vocabulary exceeds 96%. By doubling the size of the training set, the accuracy is raised to 98%. Using a suitable threshold, we are able to raise the accuracy of one network from 87% to 98.5%. Thresholding applied to all networks would then raise the overall accuracy to well over 99%.

This technique is especially promising because of the low overhead and computational requirements, which make it suitable for a low cost, portable, command recognition type of application.     

Hormone replacement therapy is associated with increased C-reactive protein in women with Type 2 diabetes in the Diabetes Heart Study.

AIMS: Increased levels of inflammatory biomarkers, especially C-reactive protein (CRP), are associated with increased risk for cardiovascular disease (CVD) events, such as myocardial infarction, stroke, peripheral vascular disease, and sudden cardiac death. Medical interventions that increase CRP levels, such as hormone replacement therapy (HRT) in post-menopausal women, are under increasing scrutiny. The effect of HRT on CRP levels in women with Type 2 diabetes (T2DM) is not well documented, and conflicting conclusions have been reported. The aim of this study was to determine the influence of HRT on women with diabetes in a large cross-sectional study. METHODS: Three hundred and twenty-seven post-menopausal women with T2DM from the Diabetes Heart Study participated. Current use of HRT was determined and serum CRP levels were measured using a high-sensitivity ELISA kit. Generalized estimating equation methods were used to assess the relationship of multiple clinical and lifestyle (e.g. smoking) measures on CRP levels including differences between women taking HRT (HRT+) and not taking HRT (HRT-). RESULTS: Overall serum CRP levels were strongly associated with body mass index (P < 0.0001) and age (P < 0.0001). Of the women, 243 were not using HRT and 84 were using HRT. HRT+ and HRT- women did not differ significantly in measures of clinical traits, with the exception of higher mean low-density lipoprotein cholesterol in HRT- women (P = 0.004). In all models tested, HRT+ women had significantly higher circulating CRP levels, with P-values ranging from 0.0045 to 0.010. CONCLUSIONS: In this study of serum CRP concentration as a function of HRT in women with Type 2 diabetes, there was consistent evidence for increased circulating CRP levels in women receiving oestrogen-containing HRT. Whether HRT-induced increases in CRP can account for the adverse cardiovascular effects of HRT remains to be established; however, based on these data, there is little reason to believe that diabetic women would be spared from such an effect.     

Nucleotide changes around the splicing acceptor of intron 24 in the factor VIII gene and its impact on splicing.

Nucleotide 6724 of the factor VIII gene harbors a polymorphism of low frequency. A report from Taiwan claimed that 97.9% of the 83 alleles examined were of the A nucleotide at this position, which is quite different to the data from Western populations. Furthermore, this nucleotide is the start of exon 25, located in juxtaposition to the splicing acceptor of intron 24. We wonder if the nucleotide change at this location might have any effect on the splicing process of pre-mRNA. Using genomic DNA with direct sequencing of the polymerase chain reaction-amplified intron 24/exon 25 junction site, we found that 59 of the 60 patient samples were of the GTG sequence at nucleotides 6724-6726. The polymorphism is similar between populations in Taiwan and Western countries. The sequence of intron 24 around the splicing acceptor was always TCCAACTCTATTGCCCTCAG (-20 to -1), except for one hemophiliac patient who had a mutation in which the absolute consensus AG doublet of the intron 24 splicing acceptor changed to the AA dinucleotide. Owing to the mutation, exon 24 was erroneously spliced to exon 26, and exon 25 was skipped. This finding further testifies to the importance of the invariant AG dinucleotide in the example of the factor VIII gene.     

Raman and UV–vis spectroscopic study of polyaniline membranes containing a bulky cationic additive

Electrically conducting soluble polyaniline (PANI), containing different amounts of a bulky lipophilic cationic additive, tridodecylmethylammonium chloride (TDMACl), was studied by Raman (λ_exc=780 nm) and UV–vis spectroscopy. PANI was made simultaneously electrically conducting and soluble with bis[4-(1,1,3,3-tetramethylbutyl)phenyl]phosphoric acid in dichloromethane. The PANI membranes were prepared by drop casting on glassy carbon or ITO substrates. Raman and UV–vis measurements were carried out in a 0.1 M CaCl₂ solution at potentials between 400 and ?600 mV (vs. SCE) at pH 6, or alternatively at the open circuit potential at pH 10. The results of Raman, UV–vis and cyclic voltammetric measurements confirm that the incorporation of TDMACl into the PANI membrane facilitates the oxidation and reduction of PANI.     

Intracapsular tonsillar reduction (partial tonsillectomy): reviving a historical procedure for obstructive sleep disordered breathing in children.

OBJECTIVE: We sought to reintroduce a historical procedure-intracapsular tonsillar reduction (partial tonsillectomy or tonsillotomy)-for tonsillar hypertrophy causing obstructive sleep disordered breathing (OSDB) in children, as well as to determine whether partial tonsillectomy, compared with conventional (total) tonsillectomy when performed by more than one surgeon, is equally effective for the relief of OSDB while resulting in less pain and more rapid recovery. STUDY DESIGN: We conducted a retrospective case series at a tertiary children's hospital. The charts of children who underwent partial tonsillectomy and total tonsillectomy (1998 through 2002) for postoperative complications were reviewed. The caregivers were surveyed to assess postoperative pain, rapidity of recovery, and effectiveness of surgery for relieving symptoms of OSDB. RESULTS: Two hundred forty-three children underwent partial tonsillectomy and 107 children underwent total tonsillectomy. There were no significant differences in immediate and delayed complications between the groups. Both operations were equally effective in relieving OSDB. Children who had partial tonsillectomy had significantly less postoperative pain and significantly more rapid recovery. CONCLUSION: Intracapsular tonsillar reduction with an endoscopic microdebrider relieves OSDB as effectively as conventional tonsillectomy, but results in less postoperative pain and a more rapid recovery.     

Sonography of a human jackstone calculus.

Jackstone calculi are urinary tract stones that have a specific appearance resembling toy jacks. They are almost always composed of calcium oxalate dihydrate and may be found in the urinary bladder or rarely in the upper urinary tract. Their appearance on plain radiographs and computed tomography (CT) in human patients has been well described. They have also been imaged in several species of animals. However, our review of the English medical literature revealed no previous report in which a jackstone calculus had been identified on the sonographic examination of a human patient. We report a case in which a large jackstone calculus was incidentally detected during abdominal sonography in a 75-year-old man.