High order interactions of xenobiotic metabolizing genes and P53 codon 72 polymorphisms in acute leukemia

Polymorphisms in xenobiotic metabolizing genes are associated with altered metabolism of carcinogens in acute leukemia (AL). This study applied two data mining approaches to explore potential interactions among P53 and xenobiotic metabolizing genes in 230 AL patients [131 acute myeloid leukemia (AML) and 99 acute lymphoblastic leukemia (ALL)] and 199 controls. Individually, none of the genotypes showed significant associations with AML risk. However, in ALL the CYP1A12A TC genotype was associated with increased risk (OR = 2.02; 95% CI = 1.14–3.58; P = 0.01), whereas the GSTM1 null genotype imparted reduced risk (OR = 0.55; 95% CI = 0.31–0.96; P = 0.03). In classification and regression tree analysis, combinations of GSTM1 present, CYP1A12C AA or GG, EPHX1 exon3 TC, and EPHX1 exon4 AA or GG genotype strongly enhanced the risk of AML (OR = 5.89; 95% CI = 1.40–26.62; P = 0.01). In ALL, combinations of CYP1A12A TT, P53 GG or CC and GSTP1 AG genotypes conferred the highest risk (OR = 4.19; 95% CI = 1.45–12.25; P = 0.004). In multifactor dimensionality reduction analysis, a four locus model (GSTP1, P53, EPHX1 exon3, and CYP1A12A) was the best predictor model for ALL risk. The association between this model and ALL risk remained true even at low prior probabilities of 0.01% (false positive report probability = 0.05). Interaction entropy interpretations of the best model of ALL revealed that two‐way interactions were mostly synergistic. These results suggest that high order gene–gene interactions play an important role in AL risk. Environ. Mol. Mutagen., 2012. © 2012 Wiley Periodicals, Inc.     

Prognostic significance of soluble fas and soluble fas ligand in serum of patients with complete hydatidiform moles

Citation Soni S, Rath G, Deval R, Salhan S, Mishra AKumar, Saxena S. Prognostic significance of soluble Fas and soluble Fas ligand in serum of patients with complete hydatidiform moles. Am J Reprod Immunol 2011; 66: 230–236 Problem Despite of advances in diagnosis and staging, the prognosis of hydatidiform mole (HM) remains intricate. HM possesses the substantial risk of developing persistent trophoblastic disease (PTD), which is considerably high for complete hydatidiform moles (CHMs). Significance of serum soluble Fas (sFas) and soluble FasL (sFasL) has been observed in various malignancies; however, there is no report till date on HM. Method of study The serum levels of sFas and sFasL were measured using enzyme‐linked immunosorbent assay in 62 patients with CHMs and 64 healthy controls. The protein concentrations were also correlated with clinicopathological parameters, β‐hCG level, and clinical outcome. Results The serum sFas and sFasL levels in patients with CHM were significantly higher than those in control group (mean ± SD: 703.497 ± 491.759 versus 348.141 ± 175.24; P < 0.004 and 31.17 ± 18.758 versus 18.802 ± 6.775; P < 0.0001, respectively). Patients who progressed to PTD demonstrated higher sFas and sFasL concentrations than those who regressed spontaneously (794.211 ± 415.892 versus 446.69 ± 161.382; P < 0.046 and 37.55 ± 20.337 versus 22.763 ± 6.52; P < 0.011, respectively). Furthermore, significant associations were observed among sFas, sFasL, and β‐hCG levels (P < 0.0001 for all associations). Conclusion Production of sFas and sFasL may play a crucial role in progression of CHM and may serve both as prognostic tool and therapeutic target in improving the clinical outcome.     

Upregulation of KIR expression on murine bone marrow cells by paraformaldehyde fixed tumor cells

We have previously shown that the activation of mouse spleen NK cells by IL2 is markedly boosted if paraformaldehyde fixed tumor target cells are added during the activation phase. In the present study, we have shown that such a boosting effect is not seen if mouse bone marrow (BM) cells are used instead of spleen cells. Addition of fixed tumor cells (1:100 ratio of tumor cells to BM cells) however resulted in a marked increase in the expression of Ly49 molecules on BM cells. The enhancement of Ly49 expression was not seen if fixed allogeneic BM cells were added, suggesting that Ly49 upregulation was tumor specific. Expression of Ly49A as well as Ly49C isotypes were augmented by fixed tumor cells. Moreover, increased Ly49 expression was seen on cell populations expressing TCRbeta as well as NK1.1 markers. These results indicate that exposure to tumor cells may be an important factor regulating KIR expression on NK and T cells. Implications of these results are discussed.     

Multiaxial mechanical response and constitutive modeling of esophageal tissues: Impact on esophageal tissue engineering

Congenital defects of the esophagus are relatively frequent, with 1 out of 2500 babies suffering from such a defect. A new method of treatment by implanting tissue engineered esophagi into newborns is currently being developed and tested using ovine esophagi. For the reconstruction of the biological function of native tissues with engineered esophagi, their cellular structure as well as their mechanical properties must be considered. Since very limited mechanical and structural data for the esophagus are available, the aim of this study was to investigate the multiaxial mechanical behavior of the ovine esophagus and the underlying microstructure. Therefore, uniaxial tensile, biaxial tensile and extension-inflation tests on esophagi were performed. The underlying microstructure was examined in stained histological sections through standard optical microscopy techniques. Moreover, the uniaxial ultimate tensile strength and residual deformations of the tissue were determined. Both the mucosa-submucosa and the muscle layers showed nonlinear and anisotropic mechanical behavior during uniaxial, biaxial and inflation testing. Cyclical inflation of the intact esophageal tube caused marked softening of the passive esophagi in the circumferential direction. The rupture strength of the mucosa-submucosa layer was much higher than that of the muscle layer. Overall, the ovine esophagus showed a heterogeneous and anisotropic behavior with different mechanical properties for the individual layers. The intact and layer-specific multiaxial properties were characterized using a well-known three-dimensional microstructurally based strain-energy function. This novel and complete set of data serves the basis for a better understanding of tissue remodeling in diseased esophagi and can be used to perform computer simulations of surgical interventions or medical-device applications.     

Poly(ADP-ribose) polymerase at active centromeres and neocentromeres at metaphase

A double-stranded 9 bp GTGAAAAAG pJ alpha sequence found in human centromeric alpha-satellite DNA and a 28 bp ATGTATATATGTGTATATAGACATAAAT tandemly repeated AT28 sequence found within a cloned neo- centromere DNA have each allowed the affinity purification of a nuclear protein that we have identified as poly(ADP-ribose) polymerase (PARP). Use of other related or unrelated oligonucleotide sequences as affinity substrates has indicated either significantly reduced or no detectable PARP purification, suggesting preferential but not absolute sequence-specific binding. Immunofluorescence analysis of human and sheep metaphase cells using a polyclonal anti-PARP antibody revealed centromeric localization of PARP, with diffuse signals also seen on the chromosome arms. Similar results were observed for mouse chromosomes except for a significantly enlarged PARP-binding region around the core centromere-active domain, suggesting possible 'spreading' of PARP into surrounding non-core centromeric domains. Enhanced PARP signals were also observed on alpha-satellite-negative human neo- centromeres and on the active but not the inactive alpha-satellite-containing centromere of a human dicentric chromosome. PARP signals were absent from the q12 heterochromatin of the Y chromosome, suggesting a correlation of PARP binding with centromere function that is independent of heterochromatic properties. Preliminary cell cycle analysis indicates detectable centromeric association of PARP during S/G(2)phase and that the total proportion of PARP that is centromeric is relatively low. Strong binding of PARP to different centromere sequence motifs may offer a versatile mechanism of mammalian centromere recognition that is independent of primary DNA sequences.     

18Fluoro-deoxyglucose positron emission tomography evaluation of benign versus malignant osteochondromas: preliminary observations

OBJECTIVE: To determine the contribution of 18fluoro-deoxyglucose positron emission tomography (18FDG PET) in distinguishing benign from malignant osteochondromas. MATERIALS AND METHODS: From 2000 to 2004, 10 patients (4 females, 6 males, 12 to 64 years old) with osteochondromas were referred for whole body PET by clinicians for metabolic evaluation before planned surgery for pain or cosmesis. Two PET readers and 1 pathologist, blinded to their diagnoses and imaging studies (except for radiographs), correlated results post surgery. The PET average and maximum standard uptake value (SUV) generated by computer for Regions of Interest and correlated with radiographs, were based on axial 3.37 mm thick, 3 x 3 mm pixel images. Since SUVs vary from site to site depending on scanning devices and techniques, a 2.0 maximum cutoff SUV separated benign and malignant osteochondromas based on our standard protocols and specific equipment (Siemens Ecat Exact Knoxville, Tenn) used with our prior oncological studies. RESULTS: Results showed that no definitive statistical conclusions could be drawn due to the small number of patients involved, but they were, nevertheless, deemed promising. CONCLUSIONS: The 18FDG whole body PET aided the identification of malignant osteochondromas, their local recurrence and metastases by both displaying and quantifying their metabolic activity. Although the current study is limited by a small cohort, which precludes statistical analysis, additional experience with PET analysis of osteochondromas may further support its value as a physiological parameter supplementing anatomically based imaging modalities most often used for their evaluation.     

Normal and stenotic renal arteries: experimental balloon-expandable intraluminal stenting

Elastic recoil of the vessel wall is a common cause of failure of percutaneous transluminal angioplasty in renal arteries. To oppose such recoil, balloon-expandable metal stents were implanted in artificially stenotic renal arteries in pigs and normal renal arteries in dogs and pigs. The stents were then examined angiographically and histologically at regular intervals. All stents were completely covered with endothelialized neointima in 3 weeks. There was no difference in intimal thickness between the stenotic and nonstenotic renal arteries. A large stent diameter and a large open or nonmetal surface may cause less intimal hyperplasia, but nonturbulent, fast arterial flow is probably the most important factor in ensuring long-term patency of the vessel.     

Obsessive–compulsive disorder: a review of the diagnostic criteria and possible subtypes and dimensional specifiers for DSM‐V

Background: Since the publication of the DSM‐IV in 1994, research on obsessive–compulsive disorder (OCD) has continued to expand. It is timely to reconsider the nosology of this disorder, assessing whether changes to diagnostic criteria as well as subtypes and specifiers may improve diagnostic validity and clinical utility. Methods: The existing criteria were evaluated. Key issues were identified. Electronic databases of PubMed, ScienceDirect, and PsycINFO were searched for relevant studies. Results: This review presents a number of options and preliminary recommendations to be considered for DSM‐V. These include: (1) clarifying and simplifying the definition of obsessions and compulsions (criterion A); (2) possibly deleting the requirement that people recognize that their obsessions or compulsions are excessive or unreasonable (criterion B); (3) rethinking the clinical significance criterion (criterion C) and, in the interim, possibly adjusting what is considered “time‐consuming” for OCD; (4) listing additional disorders to help with the differential diagnosis (criterion D); (5) rethinking the medical exclusion criterion (criterion E) and clarifying what is meant by a “general medical condition”; (6) revising the specifiers (i.e., clarifying that OCD can involve a range of insight, in addition to “poor insight,” and adding “tic‐related OCD”); and (7) highlighting in the DSM‐V text important clinical features of OCD that are not currently mentioned in the criteria (e.g., the major symptom dimensions). Conclusions: A number of changes to the existing diagnostic criteria for OCD are proposed. These proposed criteria may change as the DSM‐V process progresses. Depression and Anxiety, 2010. © 2010 Wiley‐Liss, Inc.