Band atrophy of the optic nerve: A report on different anatomical locations in three patients

Lesions of the optic tract are accompanied by various signs that help to distinguish them from hemianopias located posterior to the lateral geniculate body. Band optic nerve atrophy is one of these signs and typically occurs contralateral to the optic tract lesion. We report on three patients with band atrophy in the fundus of the eye. These three patients present examples of how three lesions with different anatomic locations can cause band atrophy of the optic disk in similar ways. In these cases, the presence of relative afferent pupillary defect (RAPD) and band atrophy becomes important in identifying the injury to the optic tract, because when the hemianopia is complete visual fields do not allow distinguishing optic tract lesions from occipital lesions. The RAPD occurs in the eye in which the visual field defect is greater. In this paper we review the different theories about the explanation for RAPD in patients with optic tract lesions. It does not seem as simple as the anatomical differences between the number of fibers that decussate in particular cases, rather, it is associated with the difference between the sensitivity levels of the two functioning hemiretinas.     

Association of sodium voltage-gated channel genes polymorphisms with epilepsy risk and prognosis in the Saudi population

BackgroundEpilepsy is a heterogeneous complex condition that involve the human brain. Genetic predisposition to epilepsy is a fundamental factor of the disorder aetiology. The sodium voltage-gated channel (SCN) genes variants are critical biomarker for the epilepsy development and progression. In this study, we aimed to investigate the association of several SNCs genetic polymorphisms with epilepsy risk and their intrudance of the disease prognosis.MethodsBlood samples were withdrawn from 296 Epilepsy patients in addition to 293 healthy matched participants prior to DNA extraction. PCR-sequencing was used for genotyping analysis. Genotyping outputs were then statistically analysed for genotype/phenotype evaluation.ResultsWithin SCN1A gene we found that the rs6432861 (p = 0.014) was in correlation with the risk of epilepsy. In addition, both rs4667485 and rs1469649 of SCN2A gene were significantly correlated to epilepsy risk for both allelic (4e-4 and 1e-3) and genotypic (1e-3 and 5e-3). Moreover, the haplotype analysis showed that the GATGCTCGGTTTCGCTACGCA haplotype of SCN2A gene was significantly related to epilepsy increased risk, p = 6e-3, OR (CI) = 2.02 (1.23–3.31). In relevant to our finding, many of the investigated SCNs variants in the current study were related to several clinical features of epilepsy.ConclusionIn light of our results, we infer that SCN genes polymorphisms are strong candidates for epilepsy development and progression. Furthermore, these variant are essential for the disorder prognosis and medications outcomes.

Key Messages

• Genetic polymorphisms of sodium channels SCN1A, SCN2A and SCN3A were found to be associated with the risk of epilepsy.
• SCN1B polymorphisms were found to be correlated to epilepsy reduced risk.
• SCNs variants are involved in the epilepsy prognosis and response to treatment.

     

Influence of methionine synthase (A2756G) and methionine synthase reductase (A66G) polymorphisms on plasma homocysteine levels and relation to risk of coronary artery disease

BACKGROUND: Elevated plasma total homocysteine (tHcy) is increasingly being recognized as a risk factor for coronary artery disease (CAD) and other defects. Recent genetic studies have characterized molecular determinants contributing to altered homocysteine metabolism. Our objectives were therefore to confirm the relationship of tHcy with CAD and to examine the importance of genetic influence on tHcy in the coronary angiograms and conventional cardiovascular risk factors recorded in 230 subjects. We also determined the genotype frequencies distribution of the A2756G transition of the B12-dependent methionine synthase (MTR) gene and the A66G mutation of the methionine synthase reductase (MTRR) gene. RESULTS: Patients with CAD (n=151) had significantly higher tHcy concentrations than control subjects (15.49 +/- 2.75 micromol/l vs. 11.21 +/- 3.54 micromol/l, P < 0.001). Hyperhomocysteinaemia (tHcy > or =15 micromol/l) was a risk factor for CAD [RR = 4.07, 95% CI: 2.21 - 7.47, P < 0.001]. The homocysteine concentrations were significantly different between smokers and non-smokers, at 15.63 +/- 3.10 vs. 12.45 +/- 3.84 micromol/l, P < 0.05. In addition, smokers with hyperhomocysteinaemia demonstrated a markedly increased risk of CAD (OR = 2.50, 95% CI: 1.67 - 3.32, P < 0.05) compared with non-smokers with normal homocysteine.The 2756G and the 66G allele contribute to a moderate increase in homocysteine levels (P = 0.008 and P = 0.007, respectively), but not to CAD (P > 0.05). Combined MTR and MTRR polymorphisms, the 2756AG + 66AG and the 2756AG + 66GG were the combined genotypes that were a significant risk factor for having hyperhomocysteinaemia (14.4 +/- 2.8 micromol/l, OR = 2.75, IC 95% = 1.21 - 6.24, P=0.016 and 17.9 +/- 4.1 micromol/l, OR = 6.28, IC 95% = 1.46 - 12.1, P = 0.021, respectively). Statistic analysis using the UniANOVA test shows that these two polymorphisms have an interactive effect circulating homocysteine levels (P < 0.05). CONCLUSION: Our data suggest that moderately elevated tHcy levels are prevalent in our population and are associated with an increased risk for CAD. This study provides evidence that the MTR A2756G and MTRR A66G polymorphisms significantly influence the circulating homocysteine concentration. In addition, the MTR and MTRR genes may interact to increase the risk for having hyperhomocysteinaemia.     

Sleep disturbance in Moroccan patients with ankylosing spondylitis: Prevalence and relationships with disease-specific variables, psychological status and quality of life

Sleep disturbance is often reported by the patients with ankylosing spondylitis (AS), with awakenings produced by inflammatory pain. There are limited studies about sleep disturbance on these patients, and especially its association with psychological state and quality of life to examine the prevalence of sleep disturbance and to assess its association with disease-specific variables, psychological status and quality of life. One hundred and ten patients were included in this cross-sectional study according to the modified New York criteria for AS. Clinical and biological parameters were evaluated. Sleep disturbance was assessed by the fourth item of Hamilton Anxiety Scale. Psychological status was assessed by The Hospital Anxiety and Depression Scale including depression subscale and anxiety subscale. The quality of life was evaluated by the short form-36 (SF-36). Sleep disturbance was found in 64.5 %, depression in 55.5 % and anxiety in 60.9 % amongst our patients. Significantly, worse pain, higher disease activity and functional disability were present in patients with sleep disturbance. Likewise, sleep problems were significantly higher in patients with depression, anxiety and in patients with low scores of the SF36. Multivariate logistic regression analysis revealed that the pain (OR = 1.019) and depression (OR = 1.304) were independent risk factors that influenced sleep disturbance. Sleep problems are prevalent amongst Moroccan patients with AS. Our findings suggest that pain and depression were the independent risk factors that influenced the sleep disturbance and hence, the need for evaluation and optimal management of pain and depression to improve sleep quality in AS patients.     

Synthesis of 5-phenyl-1-(3-pyridyl)-1H-1,2,4-triazole-3-carboxylic acid derivatives of potential anti-inflammatory activity

A series of 5-phenyl-1-(3-pyridyl)-1H-1,2,4-triazole-3-carboxylic acid derivatives 4-10 were synthesized by rearrangement of 4-(3-pyridyl)-hydrazono-2-phenyl-2-oxazolin-5-one 3 in the presence of different nucleophiles to afford derivatives 4, 7, and 8, while hydroxamic acid derivative 6 was prepared from reaction of methyl ester 4 with hydroxylamine hydrochloride. Semicarbazide 9 and thiosemicarbazide 10, derivatives of the 5-phenyl-1-(3-pyridyl)-1H-1,2,4-triazole-3-carboxylic acid, were synthesized via hydrazide 8 with potassium cyanate and appropriate isothiocyanate, respectively. The structures of the synthesized compounds were confirmed by elemental analyses, IR, (1)H-NMR, and mass spectra. The results of the anti-inflammatory activity of the synthesized derivatives showed that most of the tested compounds 4-10 showed significant inhibition against carrageenan-induced rat paw edema in albino rats. Derivatives 4 and 8 showed promising results and were found to be equipotent or more potent than Indomethacin and Celecoxib as reference drugs at two dose levels, 5 and 10 mg/kg, and they have no ulcerogenic activity.     

Inula Viscosa Extracts Induces Telomere Shortening and Apoptosis in Cancer Cells and Overcome Drug Resistance

Telomerase is activated in human papillomavirus (HPV) positive cervical cancer and targeting telomeres offers a novel anticancer therapeutic strategy. In this study, the telomere targeting properties, the cytotoxic as well as the pro-apoptotic effects of hexane (IV-HE) and dichloromethane (IV-DF) fractions from Inula viscosa L. extracts were investigated on human cervical HeLa and SiHa cancer cells. Our data demonstrate that IV-HE and IV-DF extracts were able to inhibit cell growth in HeLa and SiHa cells in a dose-dependent manner and studied resistant cell lines exhibited a resistance factor less than 2 when treated with the extracts. IV-HE and IV-DF extracts were able to inhibit telomerase activity and to induce telomere shortening as shown by telomeric repeat amplification protocol and TTAGGG telomere length assay, respectively. The sensitivity of fibroblasts to the extracts was increased when telomerase was expressed. Finally, IV-HE and IV-DF were able to induce apoptosis as evidenced by an increase in annexin-V labeling and caspase-3 activity. This study provides the first evidence that the IV-HE and IV-DF extracts from Inula viscosa L. target telomeres induce apoptosis and overcome drug resistance in tumor cells. Future studies will focus on the identification of the molecules involved in the anticancer activity.     

A STUDY OF KNOWLEDGE,ATTITUDE, AND PRACTICE OF CERVICAL SCREENING AMONG FEMALE PRIMARY CARE PHYSICIANS IN THE UNITED ARAB EMIRATES

Cancer is the third leading cause of death In the United Arab Emirates (UAE), which is situated in the Arabian Gulf. A national programme for cervical cancer screening is likely to be implemented in the future. In this study, we assessed the knowledge, attitude, and practice of UAE female primary care physicians of cervical screening through a self-administered questionnaire. Of the 98 physicians who participated in the study only 40% reported ever having performed a Pap smear. In the study, we identified various training needs, and a training programme on cervical screening currently is being developed based on the results of this study.     

Management of Dens Invaginatus Type II Associated with Immature Apex and Large Periradicular Lesion Using Platelet-rich Fibrin and Biodentine

Dens invaginatus (DI) poses peculiar challenges in endodontic treatment of teeth because of distortion of pulpal space. A case of Oehlers type II DI with open apex and large periapical lesion is reported. The case was managed using cone-beam computed tomography (CBCT), operating microscope, platelet-rich fibrin (PRF), and Biodentine. A 15-year-old male patient presented with palatal swelling. Pulp sensibility testing of right maxillary lateral incisor was negative. Intraoral periapical digital radiograph revealed an Oehlers type II DI with open apex and periapical radiolucency. A CBCT scan was performed to study the anatomy, determine the true extent of the periapical lesion, and form a treatment plan. A diagnosis of Oehlers type II DI with pulp necrosis and acute periapical abscess was made. Two-visit endodontic treatment was performed. In the first visit, the invaginated central mass was removed under operating microscope, chemo-mechanical preparation was done, and double antibiotic paste dressing was placed. In the second visit, the canal was sealed with apical matrices of PRF and Biodentine as filling material. The patient was asymptomatic and radiographs revealed continued healing of the osseous defect at follow-up visits. A CBCT scan at 30 months showed complete continuity of periodontal ligament space, healing of labial and palatal cortical plates, and formation of intercortical bone. The advances in endodontic armamentarium and technology, like CBCT and operating microscope, have made successful treatment of challenging cases possible. PRF and Biodentine as apical matrices and filling material, respectively, proved to be effective in the present case.