The significance of a rapid cold hemagglutination test for detecting mycoplasma infections in children with asthma exacerbation.

BACKGROUND AND PURPOSE: Mycoplasma pneumoniae infection is a frequent cause of community-acquired respiratory infections in children and adults. However, standardized, rapid, specific methods for its diagnosis are lacking. The relationship between M. pneumoniae infection and asthma exacerbation has been recently discussed in the literature. We investigated the accuracy of rapid detection of mycoplasma infection by cold hemagglutination test compared to conventional enzyme immunoassays. The clinical characteristics of mycoplasma infection seen during emergent visits in asthmatic children were reviewed. METHODS: We retrospectively reviewed medical records of patients with asthma exacerbation visiting the Department of Pediatric Emergency, National Taiwan University Hospital, over a 12-month period. Subjects 2-18 years of age diagnosed with asthma at our outpatient clinic were included in this study. Patients with immunodeficiency, congenital anomalies, neurological diseases and irregular follow-up were excluded. RESULTS: A total of 269 children (174 males and 95 females) with a mean (+/- standard deviation) age of 6.15 +/- 3.08 years were included. The prevalence of asthma exacerbation in regular follow-up patients was 13.4%, and as many as 19.6% of cases (74/378 person-times) required hospitalization. Asthma attacks were most prevalent during December. 126 patients had both rapid cold hemagglutination testing and mycoplasma immunoglobulin M titers determined using acute blood samples drawn in the emergency room; 46 (36.5%) of these patients demonstrated mycoplasma infection. Sensitivity and specificity of the rapid cold hemagglutination test was 78.3% and 41.3%, respectively. The positive predictive value was 43.4%. Comparison of patients with or without mycoplasma infection revealed no differences in gender, age, chest X-ray findings, and most symptoms/signs and laboratory data, except that more signs of fever and auscultatory rales were seen in the non-mycoplasma infection group. CONCLUSIONS: Mycoplasma infections could be an exacerbating factor for asthma, and the rapid cold hemagglutination test should not be a guideline for prescribing macrolides in the emergency room.     

Enzyme immunoassay of histamine in foods

A competitive enzyme immunoassay of histamine in foodstuffs has been developed using a monoclonal antibody against a histamine‐benzoquinone adduct. In this assay, histamine present in food samples was treated with 1,4‐benzoquinone to form histamine‐benzoquinone by a simple and quick reaction and a histamine‐benzoquinone‐horse‐radish peroxidase conjugate was used as the labelled hapten. The apparent association constant (K_a) of the antibody used was 3.6 ×10⁶ l/mol and Gibbs’ energy of the immune complex formation has been estimated to find the optimal incubation time of the assay. The method enabled determination of histamine in fish, cheese, wine and beer at a concentration as low as 7 ng/ml with an accuracy of ± 15%. The recovery of the immunoassay was 88.9–114%. Cross‐reactivities of histidine, tyramine, tryptamine and its derivatives were lower than 0.001% and did not affect the assay.     

Prostaglandin E1 and dibutyryl cyclic AMP enhance platelet resistance to deformation

The effect of prostaglandin E₁ (PGE₁) on platelets is mediated through the PGE₁ receptor and the consequent maintenance of the platelet's discoid shape. The effects of PGE₁ and dibutyryl cAMP (dbcAMP) on the deformability of human platelets were studied. Deformability tests based upon the micropipette aspiration on the platelets were performed by using pipettes with radii (Rp) of 0.26-0.36 gm. The time course of the extension length (Dp, in μg) of the platelets in response to aspiration with a negative pressure (ΔP) of 5 cm H₂ O (ΔP × Rp = 0.15 dynes/cm) was analyzed. PGE₁ treatment (0.1 μM) resulted in a decrease of platelet deformability as compared with results obtained for apparently non-activated, control platelets. The deformation index, i.e., Dp/Rp (PGE₁ -treated) / Dp/Rp (control), was significantly reduced to 0.90 ± 0.04. DbcAMP treatment also significantly decreased the deformability of platelets and this decrease was dbcAMP dose dependent. In contrast, colchicine- or cytochalasin D-treated platelets increased deformability. PGE₁ -treated platelets had a higher [cAMP]_i than controls. Platelets treated with PGE₁ or dbcAMP showed a reduced [Ca²⁺]i increment induced by thrombin as compared to non-treated controls. These results indicate that PGE₁ and dbcAMP treatment of platelets is accompanied by an enhancement of platelet resistance to deformation. The increased [cAMP]_i and low [Ca²⁺]_i after PGE₁ treatment may limit the rearrangement of cytoskeleton and thus enhance platelet resistance to deformation.     

Glutamic acid decarboxylase-like immunoreactivity in brainstem auditory nuclei of the rat

The distribution of GABA-producing neurons in the brainstem auditory nuclei of the rat was investigated immunohistochemically by using an antibody to glutamic acid decarboxylase (GAD). In the cochlear nuclei, GAD immunoreactive neurons are present only in the superficial granular and molecular layers, whereas terminals are found in all subdivisions of the nuclei and are particularly dense surrounding large spherical cells and one type of stellate cell. In the superior olivary complex, GAD immunoreactive neurons are located in the lateral olivary nucleus and throughout the periolivary region. Immunoreactive terminals are distributed along dendrites of principal cells of the medial and lateral olivary nuclei and are clustered around somata of globular neurons of the nucleus of the trapezoid body. An extremely dense band of immunoreactive somata and terminals is present along the ventral edge of the olivary complex. The ventral, intermediate, and dorsal nuclei of the lateral lemniscus contain small fusiform GAD-immunoreactive neurons and a moderately dense plexus of immunoreactive terminals. The inferior colliculus contains a large population of GAD-immunoreactive perikarya and an extremely dense accumulation of immunoreactive terminals in the central, dorsomedial, and external nuclei. These observations indicate that GABA systems are involved in function at all levels of the brainstem auditory pathway.     

Lack of correlation between ex vivo apical dye penetration and presence of apical radiolucencies.

OBJECTIVE: The aim of this study was to determine if there is a significant correlation between the in vivo presence of periapical radiolucency and ex vivo apical dye penetration on the same human teeth. STUDY DESIGN: Eighty-four endodontically filled teeth that were scheduled for extraction were classified into 2 groups according to the presence or absence of a periapical radiolucency and further divided into 2 subgroups according to the quality of the root canal filling. After extraction, the apical filling was evaluated by a dye penetration method. RESULTS: The dye extraction evaluation showed no correlation between apical dye penetration and the presence of a periapical radiolucency (not significant), but a statistically significant correlation with the quality of the root canal filling (P = .03). CONCLUSION: The results of the dye penetration study were correlated to the quality of the root canal filling but had no predictive value for the development of periapical radiolucency.     

Hormone replacement therapy is associated with increased C-reactive protein in women with Type 2 diabetes in the Diabetes Heart Study.

AIMS: Increased levels of inflammatory biomarkers, especially C-reactive protein (CRP), are associated with increased risk for cardiovascular disease (CVD) events, such as myocardial infarction, stroke, peripheral vascular disease, and sudden cardiac death. Medical interventions that increase CRP levels, such as hormone replacement therapy (HRT) in post-menopausal women, are under increasing scrutiny. The effect of HRT on CRP levels in women with Type 2 diabetes (T2DM) is not well documented, and conflicting conclusions have been reported. The aim of this study was to determine the influence of HRT on women with diabetes in a large cross-sectional study. METHODS: Three hundred and twenty-seven post-menopausal women with T2DM from the Diabetes Heart Study participated. Current use of HRT was determined and serum CRP levels were measured using a high-sensitivity ELISA kit. Generalized estimating equation methods were used to assess the relationship of multiple clinical and lifestyle (e.g. smoking) measures on CRP levels including differences between women taking HRT (HRT+) and not taking HRT (HRT-). RESULTS: Overall serum CRP levels were strongly associated with body mass index (P < 0.0001) and age (P < 0.0001). Of the women, 243 were not using HRT and 84 were using HRT. HRT+ and HRT- women did not differ significantly in measures of clinical traits, with the exception of higher mean low-density lipoprotein cholesterol in HRT- women (P = 0.004). In all models tested, HRT+ women had significantly higher circulating CRP levels, with P-values ranging from 0.0045 to 0.010. CONCLUSIONS: In this study of serum CRP concentration as a function of HRT in women with Type 2 diabetes, there was consistent evidence for increased circulating CRP levels in women receiving oestrogen-containing HRT. Whether HRT-induced increases in CRP can account for the adverse cardiovascular effects of HRT remains to be established; however, based on these data, there is little reason to believe that diabetic women would be spared from such an effect.     

Nucleotide changes around the splicing acceptor of intron 24 in the factor VIII gene and its impact on splicing.

Nucleotide 6724 of the factor VIII gene harbors a polymorphism of low frequency. A report from Taiwan claimed that 97.9% of the 83 alleles examined were of the A nucleotide at this position, which is quite different to the data from Western populations. Furthermore, this nucleotide is the start of exon 25, located in juxtaposition to the splicing acceptor of intron 24. We wonder if the nucleotide change at this location might have any effect on the splicing process of pre-mRNA. Using genomic DNA with direct sequencing of the polymerase chain reaction-amplified intron 24/exon 25 junction site, we found that 59 of the 60 patient samples were of the GTG sequence at nucleotides 6724-6726. The polymorphism is similar between populations in Taiwan and Western countries. The sequence of intron 24 around the splicing acceptor was always TCCAACTCTATTGCCCTCAG (-20 to -1), except for one hemophiliac patient who had a mutation in which the absolute consensus AG doublet of the intron 24 splicing acceptor changed to the AA dinucleotide. Owing to the mutation, exon 24 was erroneously spliced to exon 26, and exon 25 was skipped. This finding further testifies to the importance of the invariant AG dinucleotide in the example of the factor VIII gene.     

Sonography of a human jackstone calculus.

Jackstone calculi are urinary tract stones that have a specific appearance resembling toy jacks. They are almost always composed of calcium oxalate dihydrate and may be found in the urinary bladder or rarely in the upper urinary tract. Their appearance on plain radiographs and computed tomography (CT) in human patients has been well described. They have also been imaged in several species of animals. However, our review of the English medical literature revealed no previous report in which a jackstone calculus had been identified on the sonographic examination of a human patient. We report a case in which a large jackstone calculus was incidentally detected during abdominal sonography in a 75-year-old man.