Fluorescence in situ hybridization reveals closely correlated results in cytological and histological specimens of hematological neoplasias compared to conventional cytogenetics.

OBJECTIVES: Fluorescence in situ hybridization (FISH) has become a useful tool to identify chromosomal aberrations in non-dividing cells. Numerous studies have compared chromosomal banding analysis (CBA) and FISH on fixed cultured bone marrow cells. However, up to now, there has been no study comparing two main sources of diagnostic material, i.e. bone marrow aspirates and trephine biopsies. We therefore analyzed these materials by FISH in comparison with CBA. METHODS: CBA revealed chromosomal aberrations in 18 patients suffering from myelodysplastic syndrome (n = 13), acute myeloid leukemia (n = 3), or chronic myeloproliferative syndrome (n = 2). FISH was performed on fixed cultured bone marrow cells, aspirates and trephine biopsies from each patient. RESULTS: Percentages of aberrant cells in the different materials correlated highly with Pearson values of 0.909 for biopsy/fixed cultured cells (p < 0.001), 0.830 for biopsy/aspirate (p < 0.001) and 0.768 for aspirate/fixed cultured cells (p < 0.001). Moreover, in bone marrow biopsies peritrabecular and central intertrabecular areas yielded very similar FISH results with a high correlation (r = 0.968, p < 0.001). FISH revealed a lower proportion of aberrant cells than CBA in 90% of the specimens. CONCLUSIONS: In summary, the different materials available for the FISH examination are comparable in sensitivity and show similar quantitative results. Therefore, the use of biopsy sections for the routine FISH examination of chromosomal abnormalities is a valid method.     

Knowledge about asthma and COPD: associations with sick leave, health complaints, functional limitations, adaptation, and perceived control

We sought to investigate associations between knowledge about the disease and sick leave, health complaints, functional limitations, adaptation and perceived control. Patients with asthma (n = 101) and COPD (n = 64) underwent lung function tests and completed questionnaires. In addition, all were asked the question: ‘what is the diagnosis of your disease?’, with the response categories: ‘asthma’ and ‘COPD (chronic bronchitis or emphysema)’. Thirty-five percent of the asthma patients and 30% of the COPD patients did not know their correct diagnosis. Sick leave was not associated with knowledge about the disease in asthma and COPD. In asthma, much knowledge about management of the disease was associated with better adaptation (P = 0.01) and less perceived control over health by external factors (P = 0.02). Knowing the correct diagnosis was associated with less control over health by powerful others (P = 0.02). For COPD, more knowledge about management of the disease was associated with better adaptation (P = 0.02) and less control over health by internal factors (P = 0.01). Knowing the correct diagnosis was associated with less control over dyspnea at work (P = 0.01).     

Advanced 1H Solid‐State NMR Spectroscopy on Hydrogels, 1

Summary: The nature of the pH dependent collapse of poly(methacrylic acid) (PMAA) hydrogels is investigated using recent ¹H solid‐state NMR methods. In aqueous solution, PMAA changes from an expanded conformation at high pHs to a compact contracted form at low pHs, where hydrogen bonds play a central role. In solid‐state ¹H NMR spectra, recorded under fast magic angle spinning (MAS), dried PMAA samples previously collapsed at low pHs show characteristic signals in the spectral region of the carboxylic acid protons. With the aid of 2D ¹H‐¹H double‐quantum (DQ) MAS NMR spectra, three signals can be distinguished at 8, 10.5 and 12.5 ppm, which are attributed to free carboxylic groups and two different types of hydrogen bonded forms, respectively. The 12.5 ppm signal arises from the hydrogen bond with the shortest H? H distance, corresponding to the form that is most stable with respect to increasing temperature and pH. The weaker hydrogen‐bonded form (with a signal at 10.5 ppm) requires a slightly lower pH, while the free acid signal (at 8 ppm) emerges under the most acidic medium. Moreover, the stabilities of the hydrogen‐bonded carboxylic acid dimers can be inferred from the proton‐proton distances within the dimers, i.e. (275 ± 5) pm and (295 ± 15) pm for the protons at 12.5 and 10.5 ppm, respectively, which are determined by means of DQ MAS sideband patterns. Both the stability of the hydrogen bonds and the acidity of the protons may be related to the stereochemistry and the conformation of the PMAA chains.

     

Isolation of human immunodeficiency virus (HIV) from plasma during primary HIV infection

Human immunodeficiency virus (HIV) has been isolated from plasma in 6 of 7 patients showing clinical symptoms of a primary HIV infection. Parallel cultures from peripheral blood mononuclear cells (PBMC) yielded virus in 5 patients. In one case, virus could only be isolated from the cerebrospinal fluid but not from peripheral blood. Detectable viremia was transient and preceded the appearance of HIV specific antibodies. After cessation of acute symptoms, the frequency of HIV isolations was similar to that of asymptomatic carriers (23 and 26%, respectively). The role of the immune response in terminating detectable viremia remains to be established.     

Terminal sequences of Sindbis virus-specific nucleic acids: Identity in molecules synthesized in vertebrate and insect cells and characteristic properties of the replicative form RNA

The terminal sequences of the virus-specific nucleic acids synthesized in BHK vertebrate cells and in Aedes albopictus insect cells infected with the alphavirus Sindbis virus have been analyzed. The 26 S and 42 S plus-strand RNA molecules have the 5′-terminal sequences m⁷GpppAUAG and m⁷GpppAUAGGCGGCGUAGUACACAC, respectively. A 22 S replicative form (RF) RNA which contains an infectious 42 S plus-strand genome RNA molecule and a complementary 42 S negative-strand RNA accumulates in infected cells. The 5′-terminal sequence of the 42 S plus-strand RNA component of the RF is identical to that of the single-stranded plus-strand 42 S RNA molecule except for the absence of a 5′-terminal cap in the constituent of the RF RNA. The identification of a poly(U) sequence at the 5′-terminus of the 42 S minus strand RNA in our experiments is in accordance with earlier results obtained in other laboratories (Sawicki and Gomatos, 1976; Frey and Strauss, 1978). Analogous to our data concerning the structure of the RF RNA of the alphavirus Semliki Forest virus (Wengler et al., 1979) the 3′-terminus of the 42 S minus strand RNA component of the Sindbis virus-specific RF RNA is complementary to the 5′-terminus of the 42 S plus strand RNA molecule but in addition contains a 3′-terminal extra unpaired guanosine residue. The 3′-terminal sequence of the 42 S minus strand is strongly conserved between the two alphaviruses, Sindbis virus and Semliki Forest virus. The terminal sequences of the RF RNA synthesized in BHK and Aedes albopictus cells are identical. Analyses of the capped oligonucleotides derived from virus-specific single-stranded 42 S plus-strand RNA and from 26 S RNA strongly indicate that no base sequence differences exists between the corresponding molecules synthesized in either vertebrate or insect cells. Possible implications of these findings concerning the structure of alphavirus RF RNA and the synthesis of alphavirus-specific nucleic acids are discussed.     

Lymphocytic choriomeningitis virus

Lymphocytic choriomeningitis (LCM) virus-specific complement-fixing (CF) antigen (ECFA) has been solubilized, concentrated, and partially purified. When inoculated together with Freund's adjuvant, ECFA induced CF antibody but not neutralizing antibody or protective immunity. By itself it boosted pre-existing CF antibody but not neutralizing antibody. In double diffusion tests one line developed between ECFA and its antiserum, and a corresponding line became visible when ECFA interacted with an antiserum directed against all LCM virus-specific antigens. Absorption of either serum with ECFA abolished all ECFA-precipitating qualities. Ouchterlony tests also revealed that ECFA prepared from cells and tissues of various species is immunologically identical. By a variety of procedures ECFA was not found to be represented on the surface of either the virion or the infected cell. When purified infectious LCM virus was disrupted, a CF antigen corresponding immunologically to ECFA was set free. In double diffusion tests this antigen gave a line of identity with ECFA. Thus, ECFA appears to be an internal component of the infectious LCM virus.Part of the work reported here has been published in preliminary communications [8, 10, 24, 25].     

The Kallikrein-Kinin system and muscle metabolism—Clinical aspects

The influence of synthetic bradykinin (BK) on disturbed protein and carbohydrate metabolism was studied in chemical and manifest maturity-onset diabetics, in surgical patients and in alloxan diabetic rats. BK,mixed with insulin and injected subcutaneously twice daily in alloxan diabetic rats lowered the morning blood glucose concentration in a dose-dependent way, whereas in a control group treated with insulin only no decrease was seen. Accelerated local blood flow or enhanced vascular permeability as a cause of increased glucose uptake could be ruled out by control experiments using papaverine and eledoisin. Better metabolic control in the BK/insulin-treated group was also indicated by lower arterial levels of free fatty acids and of -hydroxybutyrate, normalized hepatic glycogen content and better growth of body weight. In healthy man an intravenous infusion of BK (80 g/h) did not influence normal fasting blood glucose concentrations, whereas elevated glucose levels in maturity-onset diabetics were continuously reduced within 100 min by 12.2±1.4%. A comparable diabetic group receiving saline alone showed no spontaneous drop of blood glucose concentration. An improvement of pathological carbohydrate metabolism by infusion of BK i.v. could also be demonstrated using the intravenous glucose tolerance test in chemical and manifest maturity-onset diabetics and in surgical patients: in all groupsk values of the glucose tolerance test were significantly increased by BK. This effect was neither due to stimulated insulin release nor to changed glucose pool or to increased renal glucose loss, which was even reduced by BK. Interestingly, normalk values in healthy volunteers were not further improved by BK. A stimulated protein breakdown, which occurs after surgery due to peripheral insulin resistance, can also be restricted by intravenous infusion of BK: in surgical patients urinary nitrogen excretion was reduced by 50% during infusion of BK and was accelerated again after cessation of the infusion. These results indicate that BK can improve the efficacy of exogenous insulin in insulin-deficient animals and depressed insulin sensitivity in maturity-onset diabetics and surgical patients.     

Hypergammaglobulinemia and autoantibody induction mechanisms in viral infections

Polyclonal hypergammaglobulinemia is a characteristic of chronic inflammatory conditions, including persisting viral infections and autoimmune diseases. Here we have studied hypergammaglobulinemia in mice infected with lymphocytic choriomeningitis virus (LCMV), which induces nonspecific immunoglobulins as a result of switching natural IgM specificities to IgG. The process is dependent on help from CD4+ T cells that specifically recognize LCMV peptides presented by B cells on major histocompatibility complex class II molecules. Thus, hypergammaglobulinemia may arise when specific helper T cells recognize B cells that have processed viral antigens irrespective of the B cell receptor specificity. This nonspecific B cell activation may contribute to antibody-mediated autoimmunity.     

Human defensins

Antimicrobial peptides are small, cationic, amphiphilic peptides of 12–50 amino acids with microbicidal activity against both bacteria and fungi. The eukaryotic antimicrobial peptides may be divided into four distinct groups according to their structural features: cysteine-free -helices, extended cysteine-free -helices with a predominance of one or two amino acids, loop structures with one intramolecular disulfide bond, and -sheet structures which are stabilised by two or three intramolecular disulfide bonds. Mammalian defensins are part of the last-mentioned group. The mammalian defensins can be subdivided into three main classes according to their structural differences: the -defensins, -defensins and the recently described -defensins. Mammalian -defensins are predominantly found in neutrophils and in small intestinal Paneth cells, whereas mammalian -defensins have been isolated from both leukocytes and epithelial cells. Recently, two novel human -defensins, human beta-defensin-3 (HBD-3), and human beta-defensin-4 (HBD-4) have been discovered. Similar to HBD-1 and HBD-2, HBD-3 has microbicidal activity towards the Gram-negative bacteria (Pseudomonas aeruginosa, Escherichia coli) and the yeasts Candida albicans and Malassezia furfur. In addition, HBD-3 kills Gram-positive bacteria such as Streptococcus pyogenes or Staphylococcus aureus, including multi-resistant S. aureus strains, and even vancomycin-resistant Enterococcus faecium. In contrast to HBD-1 and HBD-2, significant expression of HBD-3 has been demonstrated in non-epithelial tissues, such as leukocytes, heart and skeletal muscle. HBD-4 is expressed in certain epithelia and in neutrophils. Its bactericidal activity against P. aeruginosa is stronger than that of the other known -defensins. Here we present an overview of human antimicrobial peptides with some emphasis on their antifungal properties.J.J. Schneider and A. Unholzer contributed equally to this work