Nucleotide changes around the splicing acceptor of intron 24 in the factor VIII gene and its impact on splicing.

Nucleotide 6724 of the factor VIII gene harbors a polymorphism of low frequency. A report from Taiwan claimed that 97.9% of the 83 alleles examined were of the A nucleotide at this position, which is quite different to the data from Western populations. Furthermore, this nucleotide is the start of exon 25, located in juxtaposition to the splicing acceptor of intron 24. We wonder if the nucleotide change at this location might have any effect on the splicing process of pre-mRNA. Using genomic DNA with direct sequencing of the polymerase chain reaction-amplified intron 24/exon 25 junction site, we found that 59 of the 60 patient samples were of the GTG sequence at nucleotides 6724-6726. The polymorphism is similar between populations in Taiwan and Western countries. The sequence of intron 24 around the splicing acceptor was always TCCAACTCTATTGCCCTCAG (-20 to -1), except for one hemophiliac patient who had a mutation in which the absolute consensus AG doublet of the intron 24 splicing acceptor changed to the AA dinucleotide. Owing to the mutation, exon 24 was erroneously spliced to exon 26, and exon 25 was skipped. This finding further testifies to the importance of the invariant AG dinucleotide in the example of the factor VIII gene.     

Immunohistochemical study of lymph nodes in patients with cat scratch disease.

BACKGROUND/PURPOSE: Bartonella henselaeis the causative agent of cat scratch disease (CSD), manifesting as fever and acute regional lymphadenopathy. Although serologic testing is the reference method for diagnosis, successful use of immunohistochemical (IHC) stain of regional lymph nodes for the diagnosis of CSD has been reported. To determine the characterization and diagnostic potential of IHC in lymphadenopathy of CSD, lymph nodes were excised from patients with suspected CSD for further evaluation. METHODS: Polyclonal antibody-based IHC studies were performed for the detection of B. henselae. Between January 2001 and December 2004, the reference laboratory of the Center for Disease Control, Taiwan, received a total of 377 sera from 352 reported suspected CSD cases. Twenty-three formalin-fixed paraffin-embedded lymph nodes from 16 patients and two skin biopsies from two patients suspected of having CSD were included in this study. Nine of them were serologically confirmed to have CSD and the others were seronegative but suspected to have CSD by the attending physicians. Seven lymph node specimens were obtained from tuberculosis patients for comparison. RESULTS: We demonstrated that the microorganisms existed in the cytoplasm of histiocytes within the granulomatous lesions in nine lymph nodes and one skin biopsy. Among the nine lymph nodes with IHC (+) stains, three were seronegative. On the other hand, three cases were IHC (+) and six cases were IHC (-) among nine seronegative patients. In addition, two seronegative patients with skin biopsy showed one IHC (+) and one IHC (-). CONCLUSION: IHC can contribute to the etiologic diagnosis of B. henselaelymphadenopathy when serology and molecular techniques are not available.     

Magnetic nanoparticle labeling of mesenchymal stem cells without transfection agent: cellular behavior and capability of detection with clinical 1.5 T magnetic resonance at the single cell level.

The purpose of this work was to evaluate the efficacy of labeling human mesenchymal stem cells (hMSCs) by ionic superparamagnetic iron oxide (SPIO) without a transfection agent and verifying its capability to be detected with clinical 1.5 T magnetic resonance (MR) at the single-cell level. Human hMSCs were incubated for 24 h with an ionic SPIO, Ferucarbotran. The labeling efficiency of hMSCs was determined by iron content measurement spectrophotometrically, and the influence of labeling on cell behavior was ascertained by examination of cell viability using the trypan blue exclusion method, cell proliferation analysis using MTT (3-(4,5-Dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide) assay, mitochondrial membrane potential (MMP) change, differentiation capacity, and reactive oxygen species (ROS) production measured by dichlorofluorescein diacetate (DCFDA) fluorescent probe. Labeled hMSCs were scanned under 1.5 T MRI with three-dimensional (3D) and two-dimensional (2D) T(2)-weighted gradient echo (GRE) pulse sequences. Human hMSC labeling without transfection agent was efficient. The iron content in hMSCs was 23.4 pg Fe/cell. No significant change was found in viability, proliferation, MMP change, ROS production, or differentiation capacity. About 45.2% of the hMSCs could be detected using 1.5 T MRI at the single cell level with 3D GRE and four repetitions.     

Prediction of functional outcomes in stroke inpatients receiving rehabilitation.

BACKGROUND AND PURPOSE: Early identification of predictive factors relevant to functional outcomes for stroke patients is important to the establishment of an effective continuing care program. The objective of this study was to identify the predictive factors related to functional outcome at discharge after stroke rehabilitation therapy. METHODS: 105 first-time stroke patients admitted to the inpatient rehabilitation department of a university-based medical center were recruited for this prospective study. The functional outcomes of the patients were assessed at admission and at discharge using the Functional Independence Measure (FIM). Severity of stroke was determined using the Canadian Neurological Scale (CNS). Age, gender, side of hemiplegia (SIDE), type of stroke (TYPE), onset to admission interval (OAI), and length of rehabilitation stay (LORS) were also included as predictor variables. RESULTS: The mean (+/- SD) FIM score at discharge (76.6 +/- 26.4) correlated strongly (r = 0.78, p < 0.001) with the admission FIM score (56.3 +/- 24.1), moderately (r = 0.46, p < 0.001) with the admission CNS score (6.1 +/- 2.2), negatively (r = -0.38, p < 0.001) with age (63.2 +/- 12.3 years), negatively (r = -0.26, p = 0.009) with OAI (24.2 +/- 16.0 days), and negatively (r = -0.29, p = 0.002) with LORS (34.7 +/- 16.8 days). Stepwise regression analyses indicated that admission FIM score, age, and admission CNS score were the strongest predictors of functional outcome and accounted for 66% of the total variation in discharge FIM total score. The admission FIM score was the best predictor and accounted for 61% of the variation. CONCLUSIONS: The findings of this study imply that the admission FIM scores for inpatients receiving stroke rehabilitation can be used to predict functional outcomes at discharge from hospital.     

Three-dimensional ultrasound diagnosis of Larsen syndrome with further characterization of neurological sequelae.

Larsen syndrome consists of skeletal dysplasia with multiple joint dislocations and a characteristic facies. The basis of this abnormality is a generalized mesenchymal disorder involving connective tissues. We describe our findings in a woman who was referred at 28 weeks' gestation due to multiple fetal anomalies suspected initially at an 18-week ultrasound examination. On three-dimensional (3D) ultrasound we found the fetus had bilateral genu recurvatum. Further 3D examination at 36 weeks confirmed the lower limb anomaly and revealed facial anomalies that led to the diagnosis of Larsen syndrome. An elective Cesarean section was performed at 38 weeks' gestation to minimize neurological sequelae. Magnetic resonance imaging was performed postnatally and showed pachygyria, colpocephaly and agenesis of the corpus callosum. In this case, 3D ultrasound facilitated the prenatal diagnosis of Larsen syndrome. A careful prenatal investigation for other associated anomalies such as those of the cardiovascular or neurological systems is warranted with this diagnosis. These associated lesions are likely to have a greater impact on prognosis than the classic symptoms of Larsen syndrome and a collaborative approach is necessary to optimize delivery and postnatal management of an affected fetus.     

Synthesis and characterization of poly(arylene ether sulfone amide)s

Methyl-substituted or unsubstituted aromatic dicarboxylic acids and diamines containing ether and sulfone linkages between phenylene units were used alone or in combination with p-phenylenediamine, m-phenylenediamine, terephthalic acid, and isophthalic acid to prepare flexible or semirigid aromatic polyamides by direct polycondensation activated by triphenyl phosphite and pyridine. The inherent viscosities of the obtained polymers ranged from 0.40 to 1.01 dL/g. The wholly flexible polyamides are amorphous, are readily soluble in N,N-dimethylacetamide, dimethyl sulfoxide, and m-cresol, and can afford transparent, flexible, and tough films by solution-casting. The polyamides prepared from p-phenylenediamine or terephthalic acid are partially crystalline and melt around 410°C. Differential scanning calorimetry shows glass transition temperature in the 202–255°C range for the wholly flexible polyamides. All the polyamides are thermally stable in excess of 400°C. The methyl-substituted polyamides had higher glass transition temperatures, but lower initial decomposition temperatures, than the corresponding unsubstituted polyamides.     

Protein and enzyme electrophoresis profiles of selected Candida species.

The cellular protein profiles and malate dehydrogenases, superoxide dismutases, alkaline phosphatases, and esterases from whole cell extracts of Candida spp. were studied with polyacrylamide gel electrophoresis. We investigated isolates that differed in their ability to assimilate sucrose as the sole carbon source. The protein and enzyme patterns of Candida tropicalis and its sucrose-negative variant "Candida paratropicalis Baker, Salkin, Pincus et D'Amato" were indistinguishable. Although the cellular protein and superoxide dismutase patterns of Candida albicans and its sucrose-negative variant "Candida stellatoidea" were quite similar, differences were noted in the profiles of the other enzymes studied. In addition, the C. stellatoidea isolates were found to be separable, on the basis of their enzyme profiles, into the same two types that have been reported by Kwon-Chung et al. (K.J. Kwon-Chung, B.L. Wickes, and W.G. Merz, Infect. Immun. 56:1814-1819, 1988).     

Immunohistochemical, in situ hybridization, and ultrastructural localization of SARS-associated coronavirus in lung of a fatal case of severe acute respiratory syndrome in Taiwan

This article describes the pathological studies of fatal severe acute respiratory syndrome (SARS) in a 73-year-old man during an outbreak of SARS in Taiwan, 2003. Eight days before onset of symptoms, he visited a municipal hospital that was later identified as the epicenter of a large outbreak of SARS. On admission to National Taiwan University Hospital in Taipei, the patient experienced chest tightness, progressive dyspnea, and low-grade fever. His condition rapidly deteriorated with increasing respiratory difficulty, and he died 7 days after admission. The most prominent histopathologic finding was diffuse alveolar damage of the lung. Immunohistochemical and in situ hybridization assays demonstrated evidence of SARS-associated coronavirus (SARS-CoV) infection in various respiratory epithelial cells, predominantly type II pneumocytes, and in alveolar macrophages in the lung. Electron microscopic examination also revealed coronavirus particles in the pneumocytes, and their identity was confirmed as SARS-CoV by immunogold labeling electron microscopy. This report is the first to describe the cellular localization of SARS-CoV in human lung tissue by using a combination of immunohistochemistry, double-stain immunohistochemistry, in situ hybridization, electron microscopy, and immunogold labeling electron microscopy. These techniques represent valuable laboratory diagnostic modalities and provide insights into the pathogenesis of this emerging infection.