Background: Aniridia is a rare developmental eye disorder characterized by complete or partial iris hypoplasia often accompanied with other ocular changes that affect the cornea, anterior chamber, lens, retina, and optic nerve. Most cases of aniridia are inherited with an autosomal dominant mode of inheritance caused by PAX6 mutations or deletions. To reveal the underlying genetic defect in a four-generation Iranian family with aniridia, we carried out a genetic screening of PAX6.
Methods: Complete ophthalmic examinations were performed for available affected family members. All PAX6 exons and their flanking regions were sequenced for affected individuals. Candidate variation was screened for segregation in the pedigree by Sanger sequencing. Bioinformatics prediction was done to evaluate the deleterious effects of the mutation on protein product. Real-time PCR was used to investigate the impact of the variant on PAX6 mRNA expression.
Results: All patients were diagnosed with isolated aniridia associated with variable phenotypic features including retinal detachment. A novel heterozygous deletion c.320_348delTGTCCGAGGGGGTCTGTACCAACGATAAC (p.Leu107HisfsX16) on PAX6 gene was detected. Decreased mRNA level of PAX6 in the affected individuals indicated that the mutation caused nonsense-mediated mRNA decay (NMD).
Conclusions: To the best of our knowledge, it is the first report on the genetics of aniridia in Iran. Segregation analysis, bioinformatics prediction and confirmation of NMD, all support the proposition that the novel observed PAX6 mutation is the cause of aniridia in the pedigree. Retinal detachment in some of the affected members, which is a rare reported phenotypic feature of aniridia patients, may be associated with this mutation. 相似文献
In order to develop a possible C-X-C chemokine receptor type 4 (CXCR4) imaging agent for oncological scintigraphy, [67Ga]-labeled 1,1′-[1,4-Phenylene-bis(methylene)]bis(1,4,8,11-tetraazacyclotetradecane) ([67Ga]-AMD3100) was prepared by using [67Ga]GaCl3 and AMD-3100 for 2 h at 50 °C (radiochemical purity: >95% ITLC, >99% HPLC, specific activity: 1800–2000 TBq/mmol) in acetate buffer. The stability of the complex was checked in the presence of human serum (37 °C) and in the final formulation for four days. The biodistribution of the labeled compound in the vital organs of wild type Sprague-Dawley rats was determined and compared with that of the free Ga3+ cation up to 48 h. Considering the spleen as the target organ, the best target:non target ratios were obtained 48 h post-injection (spleen:blood ratio; 14.5 and spleen:muscle ratio; 88.4). Initial SPECT images and biodistribution results in the wild type rats matched each other and demonstrated rapid washout of the tracer from the urinary tract. SPECT images in human breast carcinoma-bearing mice demonstrated a detectable tumor uptake in 48 h post-injection. 相似文献
Periodontal disease involves complex interactions of microorganisms and host defenses. This work investigated the associations between putative bacterial pathogens, herpesviruses and chronic periodontitis. Subgingival samples were collected from 40 periodontally healthy individuals and from 40 patients with chronic periodontitis with probing depths of ≤3 mm or ≥6 mm. Multiplex and nested polymerase chain reactions were used to identify bacterial pathogens and herpesviruses. Porphyromonas gingivalis, Tannerella forsythia, Epstein–Barr virus (EBV) type 1, cytomegalovirus (CMV), Aggregatibacter actinomycetemcomitans and EBV type 2 were detected in, respectively, 95, 75, 72.5, 50, 12.5 and 10% of sites with probing depths ≥6 mm. P. gingivalis, T. forsythia, EBV‐1 and CMV were statistically associated with probing depths ≥6 mm. A. actinomycetemcomitans and EBV‐2 showed no association with periodontitis sites, and no significant associations were found for any of the test infectious agents and probing depths ≤3 mm. Our results confirm an association between P. gingivalis, T. forsythia, EBV‐1 and CMV, and chronic periodontitis. These infectious agents may play an important synergistic role in the pathogenesis of chronic periodontitis. 相似文献
Annals of Nuclear Medicine - Hepatotoxicity remains amongst the restricting factors of Methotrexate (MTX)-associated cancer therapy, especially in high doses of chemo-drugs or prolonged treatment.... 相似文献
This study aimed to determine the penile size and its correlation with somatometric parameters in physically normal Iranian adult men. To do this, a random sample of 1500 normal men aged between 20 and 40 years underwent tape measurements of penile dimensions in the stretched state under the same condition. The mean total penile length was 11.58+/-1.45 cm, the mean granular length was 3.04+/-0.33 cm and the mean girth was 8.66+/-1.01 cm. Multivariate regression analysis showed that penile dimensions are significantly correlated with age (P=0.018), height (P<0.001) and index finger length (P<0.001). This analysis provided no evidence for significant effect of waist/hip ratio and weight on penile dimensions. As the penile augmentation is still in its experimental stage and its indications have not yet been clearly established, providing standardized data on penile dimensions seems to be necessary to make convenient decisions in the counseling and/or treatment of people with short penis concerns. 相似文献
In recent years intense activity in both academic and industrial sectors has provided a wealth of information on the human genome with an associated impressive increase in the number of novel gene sequences deposited in sequence data repositories and patent applications. This genomic industrial revolution has transformed the way in which drug target discovery is now approached. In this article we discuss how various differential gene expression (DGE) technologies are being utilized for cardiovascular disease (CVD) drug target discovery. Other approaches such as sequencing cDNA from cardiovascular derived tissues and cells coupled with bioinformatic sequence analysis are used with the aim of identifying novel gene sequences that may be exploited towards target discovery. Additional leverage from gene sequence information is obtained through identification of polymorphisms that may confer disease susceptibility and/or affect drug responsiveness. Pharmacogenomic studies are described wherein gene expression-based techniques are used to evaluate drug response and/or efficacy. Industrial-scale genomics supports and addresses not only novel target gene discovery but also the burgeoning issues in pharmaceutical and clinical cardiovascular medicine relative to polymorphic gene responses. 相似文献
Specific modifications of the proteoglycan (PG) structure of osteoarthritic (OA) dog cartilage in relation to endogenous metalloprotease activity were examined using murine anti-proteoglycan monoclonal antibodies (MoAbs). OA lesions were induced over a period of 8 weeks in crossbred dogs (Pond-Nuki model). The articular cartilage was removed and homogenized in a Tris buffer, pH 7.5, and then divided into four groups: direct PG extraction, no addition, presence of 1 mM p-aminophenyl mercuric acetate (APMA), and presence of 1 mM APMA and 10 mM o-phenanthroline, incubated for 42 h at 37 degrees C followed by PG extraction. MoAbs reactive with PG protein and carbohydrate epitopes included 1C6, 3B3, 5D4, D1B2, and m4D6. The results showed marked alterations induced by APMA activation of the endogenous metalloproteases. PG changes were apparent at at least three sites: one was either in the hyaluronic acid-binding region or between the hyaluronic-binding region and the G2 globular domain, another was between the keratan-sulfate-rich domain and the chondroitin sulfate-attachment domain, and a third was in the chondroitin sulfate-attachment domain. Constitutive metalloprotease activity resulted in less marked PG alterations with preservation of functional PG aggregation to hyaluronan. 相似文献