排序方式: 共有12条查询结果,搜索用时 15 毫秒
1.
Lisa K. Ryan Katie B. Freeman Jorge A. Masso-Silva Klaudia Falkovsky Ashwag Aloyouny Kenneth Markowitz Amy G. Hise Mahnaz Fatahzadeh Richard W. Scott Gill Diamond 《Antimicrobial agents and chemotherapy》2014,58(7):3820-3827
There is a strong need for new broadly active antifungal agents for the treatment of oral candidiasis that not only are active against many species of Candida, including drug-resistant strains, but also evade microbial countermeasures which may lead to resistance. Host defense peptides (HDPs) can provide a foundation for the development of such agents. Toward this end, we have developed fully synthetic, small-molecule, nonpeptide mimetics of the HDPs that improve safety and other pharmaceutical properties. Here we describe the identification of several HDP mimetics that are broadly active against C. albicans and other species of Candida, rapidly fungicidal, and active against yeast and hyphal cultures and that exhibit low cytotoxicity for mammalian cells. Importantly, specificity for Candida over commensal bacteria was also evident, thereby minimizing potential damage to the endogenous microbiome which otherwise could favor fungal overgrowth. Three compounds were tested as topical agents in two different mouse models of oral candidiasis and were found to be highly active. Following single-dose administrations, total Candida burdens in tongues of infected animals were reduced up to three logs. These studies highlight the potential of HDP mimetics as a new tool in the antifungal arsenal for the treatment of oral candidiasis. 相似文献
2.
In this paper, a randomly distributed plasmonic aluminum nanoparticle array is introduced on the top surface of conventional GaAs thin-film solar cells to improve sunlight harvesting. The performance of such photovoltaic structures is determined through monitoring the modification of its absorbance due to changing its structural parameters. A single Al nanoparticle array is integrated over the antireflective layer to boost the absorption spectra in both visible and near-infra-red regimes. Furthermore, the planar density of the plasmonic layer is presented as a crucial parameter in studying and investigating the performance of the solar cells. Then, we have introduced a double Al nanoparticle array as an imperfection from the regular uniform single array as it has different size particles and various spatial distributions. The comparison of performances was established using the enhancement percentage in the absorption. The findings illustrate that the structural parameters of the reported solar cell, especially the planar density of the plasmonic layer, have significant impacts on tuning solar energy harvesting. Additionally, increasing the plasmonic planar density enhances the absorption in the visible region. On the other hand, the absorption in the near-infrared regime becomes worse, and vice versa. 相似文献
3.
Mansour A. Alghamdi Laith N. AL-Eitan Ashwag Asiri Doaa M. Rababah Sultan A. Alqahtani Mohammed S. Aldarami Manar A. Alsaeedi Raghad S. Almuidh Abdulbari A. Alzahrani Ahmad H. Sakah Eman Mohamad El Nashar Mansour Y. Otaif Nawal F. Abdel Ghaffar 《Annals of medicine》2022,54(1):1938
BackgroundEpilepsy is a heterogeneous complex condition that involve the human brain. Genetic predisposition to epilepsy is a fundamental factor of the disorder aetiology. The sodium voltage-gated channel (SCN) genes variants are critical biomarker for the epilepsy development and progression. In this study, we aimed to investigate the association of several SNCs genetic polymorphisms with epilepsy risk and their intrudance of the disease prognosis.MethodsBlood samples were withdrawn from 296 Epilepsy patients in addition to 293 healthy matched participants prior to DNA extraction. PCR-sequencing was used for genotyping analysis. Genotyping outputs were then statistically analysed for genotype/phenotype evaluation.ResultsWithin SCN1A gene we found that the rs6432861 (p = 0.014) was in correlation with the risk of epilepsy. In addition, both rs4667485 and rs1469649 of SCN2A gene were significantly correlated to epilepsy risk for both allelic (4e-4 and 1e-3) and genotypic (1e-3 and 5e-3). Moreover, the haplotype analysis showed that the GATGCTCGGTTTCGCTACGCA haplotype of SCN2A gene was significantly related to epilepsy increased risk, p = 6e-3, OR (CI) = 2.02 (1.23–3.31). In relevant to our finding, many of the investigated SCNs variants in the current study were related to several clinical features of epilepsy.ConclusionIn light of our results, we infer that SCN genes polymorphisms are strong candidates for epilepsy development and progression. Furthermore, these variant are essential for the disorder prognosis and medications outcomes.
Key Messages
- Genetic polymorphisms of sodium channels SCN1A, SCN2A and SCN3A were found to be associated with the risk of epilepsy.
- SCN1B polymorphisms were found to be correlated to epilepsy reduced risk.
- SCNs variants are involved in the epilepsy prognosis and response to treatment.
4.
Yazeed A. Al-shawi Tamer A. Mesallam Nouf M. Albakheet Moath A. Alshawi Rayan M. Alfallaj Turki M. Aldrees Ashwag A. Algahtani Tahani O. Alotaibi 《Saudi medical journal》2020,41(10):1139
Objectives:To validate and assess the reliability of the new version of an Arabic speech intelligibility rating among different raters.Methods:This cross-sectional analysis was carried out between December 2018 and January 2019. Thirty cochlear-implant (CI) children (study group) and 30 subjects (control group) were enrolled. Study candidates’ speech skills were evaluated using the translated Arabic SIR by parents and original SIR by professions such as speech-language pathologists (SLPs). Inter-rater agreement, test–retest reliability, pre- and post-intervention score (responsiveness test), patient versus control score comparison (discriminant validity), and cross-validation of Arabic SIR have all been assessed.Results:There was a good sense of agreement between the post-operative SIR parents’ assessments and the professional SLPs’ assessments (r=0.920, p<0.001). The mean of study subjects pre- and post-implantation score of Arabic SIR showed a statistically significant difference (p<0.001).Conclusion:The Arabic SIR demonstrated excellent reliability with strong consistency. It showed its clinical ability in distinguishing healthy subjects from patients along with follow up of speech development skills over time. The Arabic SIR can be used by parents to evaluate post-CI progress of their children. 相似文献
5.
6.
Matteo Morotti Ashwag Albukhari Abdulkhaliq Alsaadi Mara Artibani James D. Brenton Stuart M. Curbishley Tao Dong Michael L. Dustin Zhiyuan Hu Nicholas McGranahan Martin L. Miller Laura Santana-Gonzalez Leonard W. Seymour Tingyan Shi Peter Van Loo Christopher Yau Helen White Nina Wietek David N. Church David C. Wedge Ahmed A. Ahmed 《British journal of cancer》2021,124(11):1759
Cancer is a leading cause of death worldwide and, despite new targeted therapies and immunotherapies, many patients with advanced-stage- or high-risk cancers still die, owing to metastatic disease. Adoptive T-cell therapy, involving the autologous or allogeneic transplant of tumour-infiltrating lymphocytes or genetically modified T cells expressing novel T-cell receptors or chimeric antigen receptors, has shown promise in the treatment of cancer patients, leading to durable responses and, in some cases, cure. Technological advances in genomics, computational biology, immunology and cell manufacturing have brought the aspiration of individualised therapies for cancer patients closer to reality. This new era of cell-based individualised therapeutics challenges the traditional standards of therapeutic interventions and provides opportunities for a paradigm shift in our approach to cancer therapy. Invited speakers at a 2020 symposium discussed three areas—cancer genomics, cancer immunology and cell-therapy manufacturing—that are essential to the effective translation of T-cell therapies in the treatment of solid malignancies. Key advances have been made in understanding genetic intratumour heterogeneity, and strategies to accurately identify neoantigens, overcome T-cell exhaustion and circumvent tumour immunosuppression after cell-therapy infusion are being developed. Advances are being made in cell-manufacturing approaches that have the potential to establish cell-therapies as credible therapeutic options. T-cell therapies face many challenges but hold great promise for improving clinical outcomes for patients with solid tumours.Subject terms: Immunotherapy, Cancer genomics, Cancer immunotherapy, Tumour immunology 相似文献
7.
Ashwag Aloyouny DDS MDS Eric T. Stoopler DMD FDSRCS FDSRCPS 《Special care in dentistry》2016,36(6):335-338
Vibratory angioedema (VA) is a rare, inherited type of physical urticaria characterized by acute onset of mucosal and / or cutaneous edema that is triggered by vibration. We report a case of a 63‐year‐old woman with VA elicited by use of mechanized (vibratory) dental equipment. To our knowledge, this is the first report of VA induced by mechanical dental equipment. 相似文献
8.
Ashwag A. Albukhari Hana M. Gashlan Hesham A. El-Beshbishy Ayman A. Nagy Ashraf B. Abdel-Naim 《Food and chemical toxicology》2009
Tamoxifen (TAM) is widely used in the treatment and prevention of breast cancer. Adverse effects of TAM include hepatotoxicity. Caffeic acid phenethyl ester (CAPE), an active component of propolis, has been used in folk medicine for diverse ailments. In the current study, the protective effects of CAPE against TAM-induced hepatotoxicity in female rats were evaluated. TAM (45 mg/kg/day, i.p., for 10 consecutive days) resulted in an elevation of serum alanine aminotransferase (ALT), aspartate aminotransferase (AST) and alkaline phosphatase (ALP), depletion of liver reduced glutathione (GSH) and accumulation of oxidized glutathione (GSSG) and lipid peroxidation (LPO). Also, TAM treatment resulted in inhibition of hepatic activity of glutathione reductase (GR), glutathione peroxidase (GPx), superoxide dismutase (SOD) and catalase (CAT). Further, it raised liver tumor necrosis factor-alpha (TNF-α) level and induced histopathological changes. Pretreatment with CAPE (2.84 mg/kg/day; i.p., for 20 consecutive days, starting 10 days before TAM injection) significantly prevented the elevation in serum activity of the assessed enzymes. CAPE significantly inhibited TAM-induced hepatic GSH depletion and GSSG and LPO accumulation. Consistently, CAPE normalized the activity of GR, GPx, SOD and CAT, inhibited the rise in TNF-α and ameliorated the histopathological changes. In conclusion, CAPE protects against TAM-induced hepatotoxicity. 相似文献
9.
Ashwag Yagoub Aloyouny Hamad Nasser Albagieh Rasha Hamed Al-Serwi 《World Journal of Clinical Cases》2021,9(3):685-689
BACKGROUNDHerpes simplex virus (HSV) is a highly infectious pathogen that is easily transmitted via the bodily fluids of an infected individual. This virus usually affects individuals older than six months of age, and rarely causes lesions or symptoms in younger patients.CASE SUMMARYWe present the case of a five-month-old healthy girl who presented with painful herpetic gingivostomatitis and perioral vesicles. We discuss the pathophysiology of primary HSV infection and the effect of maternal antibodies on the infant’s immune system. In addition, we explain the diagnosis, management, and prognosis of HSV infection in young infants. CONCLUSIONThis case highlights the importance of early diagnosis and management of HSV infections to decrease the risk of developing severe complications and death. 相似文献
10.