Conservation of precore and core sequences of hepatitis B virus in chronic viral carriers

Mutations in the precore region of hepatitis B virus (HBV) have been associated with failure of expression of HBV e-antigen (HBeAg), however, the prevalence of these and other mutations in HBV carriers without overt chronic liver disease remains uncertain. Homosexual or bisexual males (n = 65) with chronic HBV infection attending The Middlesex Hospital, London were studied, of whom two had clinical evidence of chronic liver disease. HBV DMA was amplified from 62 of 65 serum samples using nested and double nested polymerase chain reaction (PCR) assays. Direct sequencing of the PCR products was employed to investigate sequence variation. HBV-DNA from all available HBeAg-negative (n = 9) and selected HBeAg-positive (n = 33) sera were sequenced in the entire precore gene, the 3′ terminal portion of the X gene (aa128–154), and the 5′ terminus of the core gene (aa18–73). Sequences were highly conserved in all regions studied. Samples from two anti-HBe-seropositive patients contained mutations in the precore region. In one, a single mutation in the first amino acid resulted in a change to leucine, which would prevent translation of this region and therefore HBeAg expression. Wild type sequences were also detected in this sample. In the other sample from a patient with overt chronic liver disease, a mutation of precore amino acid 28 changed a tryptophan residue to a stop codon which would also prevent HBeAg expression. Although few such patients were studied, precore mutations may be uncommon in anti-HBe-seropositive patients without overt chronic liver disease. Possibly such mutations are not related to HBeAg to anti-HBe seroconversion, but rather they may arise in patients who remain anti-HBe seropositive for prolonged periods and they may be causally associated with the development of chronic liver disease. © 1994 Wiley-Liss, Inc.     

Frequency of hepatitis B virus 'a' determinant variants in unselected Spanish chronic carriers

The prevalence in the population of hepatitis B virus (HBV) surface antigen (HBsAg) variants that may impair diagnosis, or allow the virus to escape vaccine-induced immunity or passive immunoglobulin therapy is unknown. A genome fragment encoding HBsAg amino acids 112-212 was amplified and sequenced from the sera of 272 unselected DNA-positive, HBV-chronic carriers from Spain. The genotype and the HBsAg subtype were predicted from the sequences. Analysis of amino-acid positions 112-157 revealed single or multiple substitutions in 39% of the carriers studied. Mutations were not detected for residues 121, 135, 137, 139, 140, 141, 142, 146, 147, 148, 149, 151, 152, 153, 155, 156, and 157. Substitutions reported previously to be in association with failures of diagnostic tests or with vaccine or immunoglobulin therapy escape were found in 12.5%, 6.6%, and 9.2% of carriers, respectively. Met133Thr (2.2%); Gln129His, Met133Ile, Phe/Tyr134Asn (1.8%); Phe/Tyr134Leu, Gly145Ala (1.5%), and Pro120Thr (1.1%) were the most frequent. Other substitutions, including Gly145Arg (0.4%), were found at a frequency of less than 1%. Samples containing HBV mutants were tested with three commercial assays for HBsAg screening. Almost all the mutants reacted to the upper cut-off values of the assays, but six samples with weak reactivity with one or more of the methods were also found. Thus, HBV mutants with a potential impact on clinical and public health issues are moderately frequent among chronic carriers from Spain, although their influence on the performance of diagnostic tests seems to be slight.     

Prevalence of precore mutants in anti-HBe-positive hepatitis B virus carriers in Germany.

Hepatitis B virus (HBV) precore mutants are associated often with highly productive infection in hepatitis B surface antigen (HBsAg) carriers lacking hepatitis B e antigen (HBeAg) but positive for anti-HBe, rendering serological identification of infectious individuals unreliable. Although considered initially to be limited mostly to the Mediterranean area, more recent studies suggest a significant presence of these mutants in northern European countries. The sequence of the precore region was determined and examined for mutations from HBV isolates of 99 German chronic HBsAg carriers positive for HBV-DNA and either HBeAg (n = 15) or anti-HBe (n = 84). In addition, clinical data of individuals carrying wild-type virus and those with precore mutants were compared. HBV precore mutants were found in more than half (44/84) of all HBeAg-negative, anti-HBe-positive virus carriers. There was no difference between carriers of wild-type and precore mutant HBV in the level of viremia or in the clinical course of chronic infection. In conclusion, HBV precore mutants are common in Germany and can therefore present a diagnostic problem for serological testing. However, precore mutants do not appear to have a detrimental effect on the course of chronic HBV infection.     

Urine from chronic hepatitis B virus carriers: implications for infectivity

Horizontal transmission of hepatitis B virus (HBV) without apparent sexual or parenteral exposure is common in hyperendemic areas. In most cases, the route of transmission is unknown. To investigate urine as a potential source of infection, serum and urine from 56 chronic hepatitis B surface antigen (HBsAg) carriers were examined for the presence of HBV DNA using the polymerase chain reaction (PCR). Thirty-four of the patients were anti-hepatitis B e antigen (anti-HBe) positive and 22 were hepatitis B e antigen (HBeAg) positive. HBV DNA was detected in serum from 46 patients (82%) and in urine from 28 patients (50%). Most HBeAg-positive patients had HBV DNA detectable in urine (91%), whereas urine samples from anti-HBe-positive patients were found to contain HBV DNA to a lesser extent (24%). When comparing HBV DNA from serum and urine by an end-point titration PCR, a titration difference averaging 10(3) was found between serum and urine. A significant female predominance was also noted among the positive urine samples (P < 0.05), which was not correlated to the presence of haematuria. Detection of HBV DNA may indicate active viral replication, and thereby infectivity. Because a high proportion of chronic HBV carriers were found to have HBV DNA in urine, it is suggested that irrespective of HBeAg/anti-HBe status, urine should be regarded as a potential route of transmission and therefore be investigated further as a means of horizontal and nosocomial transmission of HBV.     

Second-generation line probe assay for hepatitis C virus genotyping.

Because of the enormous variability of hepatitis C virus (HCV), the development of reliable genotyping assays is a formidable challenge. The optimal genotyping region appears to be the 5' untranslated region (UR) because of high conservation within, but considerable variability between, genotypes. In this study, 21 probes dispersed over seven variable 5' UR areas were applied to a line probe assay (LiPA) and used to analyze 506 HCV-infected sera from different geographical regions representing a multitude of subtypes. At least 31 different reactivity patterns emerged, with 404 (80%) of 506 distributed over 11 prototype patterns, in general corresponding to subtypes 1a, 1b, 2a/2c, 2b, 3a, 5a, and 6a and several type 4 subtypes. Subtyping specificity ranged from 97% in Hong Kong to 90% in Europe but was only 11% in West Africa, while typing specificity was always 100% when samples from Vietnam were excluded. In a second evaluation, the subtype prediction by LiPA of 448 GenBank 5' UR HCV sequences was scored. Of the 58 theoretically predicted patterns, 321 sequences (72%) were covered by the 11 prototype patterns. We concluded that (i) the selected probes detected the corresponding signature motifs in the seven variable regions with 100% reliability; (ii) these motifs allowed correct type interpretation of samples collected worldwide, with the exclusion of Vietnam, Thailand, or Vietnamese patients residing in European hospitals; and (iii) subtyping specificities vary according to geographical region, with 11 prototype subtyping patterns identifying the majority of samples from Europe and the Americas. These results indicate that the LiPA is a reliable assay applicable to routine typing and subtyping of HCV specimens.     

Therapeutic vaccination in chronic hepatitis B virus carriers

Despite effective prophylactic vaccines against hepatitis B virus existing for over 20 years, more than 2.5 billion people worldwide have been exposed to the disease and approximately 370 million people are chronically infected with it. Chronic infection in more than two thirds of infected patients results in chronic liver disease, which may lead to cirrhosis, exposure to noncarcinomatous complications and hepatocellular carcinoma. Currently available therapies fail to allow complete control of viral replication in most patients. Viral persistence has been associated with a defect in the development of hepatitis B virus-specific cellular immunity. Immunomodulatory strategies to boost or to broaden the weak virus-specific T-cell response have been proposed to bypass the chronic hepatitis B infection, including hepatitis B virus envelope- and nucleocapsid-based vaccines, and new formulations for recombinant and DNA-based vaccines, which are currently being evaluated in clinical trials.     

Hepatitis B virus clearance from serum and liver after acute hepatitis delta virus superinfection in chronic HBsAg carriers

Clinical, virological, and histological findings in four HBsAg chronic carriers who cleared HBV markers from both serum and liver following HDV superinfection are described. The patients were long-term HBsAg carriers and all were HBV-DNA/HBeAg positive. Liver biopsy, obtained from three of the patients between 5 and 15 months prior to HDV superinfection, showed chronic persistent hepatitis in two and chronic active hepatitis in one. During the follow-up of 9-19 months, the patients completely recovered from acute delta hepatitis with termination of HBsAg carriage and regression of the histological feature of chronic liver damage. These data demonstrate that sometimes HDV is able to induce a permanent inhibition of its helper virus. HDV superinfection probably enhances the immune clearance of infected cells during the replicative phase of chronic HBV infection.     

Foscarnet therapy in chronic hepatitis B virus E antigen carriers

Foscarnet (trisodium phosphonoformate) is a novel antiviral agent that inhibits viral-specific DNA polymerase. In the present study, eight males with chronic HBV carriage (HBeAg and HBV-DNA seropositivity greater than 12 months) showing chronic persistent hepatitis (CPH) or chronic active hepatitis (CAH) on liver biopsy received either a continuous infusion of foscarnet at 0.15 mg/kg/min for 7 days or 180 mg/kg/day divided into three daily boluses for 2 weeks. In all eight, HBV-DNA levels fell during therapy (median, 401 pg/40 microliters serum; range, 4-3, 100) vs. pretreatment levels (median, 533 pg/40 microliters; range, 30-4, 175), but in none was HBV-DNA undetectable at any stage. Within 1 month, the HBV-DNA had risen to pretreatment levels in all but one patient (with the lowest pretreatment level), who cleared HBeAg and developed anti-HBe within 3 months. Two further patients were anti-HBe positive at 6 months, but their pretreatment serum HBV-DNA levels were already low, suggesting a high probability of spontaneous seroconversion. Toxicity was not evident with the continuous infusion, but for those receiving IV bolus therapy, serum creatinine and phosphate levels rose in three of four patients, necessitating a 25% dose reduction. There was no difference in the effect on serum HBV-DNA between the two regimes. We conclude that foscarnet has only modest antiviral activity in chronic HBV carriers.     

Hepatitis B virus strains in Thailand: Genomic variants in chronic carriers

Genetic heterogeneity of the hepatitis B virus (HBV) has been shown to influence the serological pattern and clinical picture in HBV infection. Thailand has a high transmission rate of HBV, but the molecular epidemiology of HBV strains circulating in this region was hitherto unknown. In this study, the HBV strains from 34 Thai HBsAg-positive patients were investigated. In a proportion of these samples, an antigenically important region of the S gene (n = 181, and the pre-S2 and precore genes (n = 15) were sequenced after PCR amplification. Four strains had in-frame deletions of an upstream region of the pre-S2 gene, with all deletions ending at the same nucleotide. In one of three anti-HBe positive strains without a translational stop at codon 28 of the precore gene, there was a one nucleotide insertion in the precore gene. This insertion would cause a frame shift and result in a nonsense protein being expressed, thus providing one explanation for the lack of HBeAg in this patient. Several rare or unique amino acid changes in the region between residues 120 and 161 of the S protein were found. Glycine 145 was changed to alanine in one strain, and this position showed an apparent mixture of glycine and arginine in another. In total, 10 strains displayed unexpected changes that were not related to the normal variability between subtypes or genetic subgroups. It is concluded that there is considerable heterogeneity in HBV strains in Thailand and that this could have clinical and epidemiological importance in a region with high HBV transmission rates. © Wiley-Liss, Inc.     

Selection of a precore mutant after vertical transmission of different hepatitis B virus variants is correlated with fulminant hepatitis in infants

The incidence of perinatal transmission of hepatitis B virus (HBV) depends on the HBeAg/anti-HBe status of the mother. While children of HBeAg-positive mothers have a 90% probability of acquiring a chronic hepatitis B virus carrier state, babies of anti-HBe-positive mothers are more likely to develop fulminant hepatitis within the first 3 to 4 months of life. There is evidence that precore (pre-C) mutations of the HBV can be associated with fulminant hepatitis. The pre-C region was therefore examined in sera from nine infants with fulminant hepatitis after vertical transmission, one HBeAg-positive and seven anti-HBe-positive mothers by polymerase chain reaction (PCR) and direct sequence analysis. In five mother/infant pairs the virus populations were characterized in addition by analysing clones of the amplified products. All mothers were infected with two or four variants of HBV with mutations at different positions of the preC genome including position 1896, which results in a stop codon. While the precore stop codon was detected in a portion of the virus populations of the HBeAg-positive and of four anti-HBe-positive mothers the dominating viral strain was represented by the wild type virus in three. In contrast, the virus populations of all babies showed the 1896 precore variant as the prevalent virus strain during the phase of active disease. In the surviving baby only wild type sequences were detected after recovery. Subtype ayw was found in all mothers and infants and adw2 was present in three mothers and in the surviving child. The findings suggest that all mothers carried a wild type HBV population with a certain number of different HBV variants. After transmission of the mixed virus population a selection process was started in the baby. The association of subtype ayw with the precore mutations and with the fatal outcome of the hepatitis B might be the result of a directed selection of this variant with a particular advantage in the viral life cycle. © Wiley-Liss, Inc.     

Use of a commercially available line probe assay for genotyping of hepatitis C virus 5a strains

To validate a commercially available line probe assay for samples containing the infrequently found hepatitis C virus (HCV) genotype 5a, we sequenced a 511-nucleotide fragment of the NS4b region of Belgian and South African HCV genotype 5a samples. Phylogenetic analysis of the sequence data was performed. For the 77 HCV genotype 5a samples collected, there was 100% concordance between the genotype assignment by the line probe assay and the genotyping based on nucleotide sequencing, despite sequence heterogeneity in the probe binding sites of some samples.     

Subtyping of hepatitis C virus isolates by a line probe assay using hybridization.

A reverse hybridization test (Inno-LiPA HCV; Innogenetics, N.V., Zwijnaarde, Belgium) was used for typing hepatitis C virus. All 38 samples, typed by PCR with primers from core and NS5 genes, were also genotyped by this test. Of the samples, 33 (87%) had the same subtypes by both assays. The correlations between PCR and Inno-LiPA for individual types were 77% for type I (1a), 90% for type II (1b), 100% for type III (2a), 100% for type IV (2b), and 100% for type V (3a). One of the type III (2a) samples also reacted with type I (1a) probes in the Inno-LiPA test.     

The absence of hepatitis B virus DNA in hepatitis B e antigen positive sera from chronic hepatitis B surface antigen carriers in China

Sera from 20 Chinese patients with chronic hepatitis B were examined for hepatitis B e antigen and hepatitis B virus (HBV) DNA. There was considerable discordance with HBV DNA not being detectable in 10 out of 13 (77%) patients who were hepatitis B e antigen positive. Further testing for anti-HBe and HBV-DNA polymerase activity confirmed the results. Possible reasons for this discordance are discussed but neither hepatitis D (delta) infection nor the acquired immunodeficiency syndrome (AIDS) could be implicated.     

An oligonucleotide probe for the detection of hepatitis B virus DNA in serum

A novel and practical assay for the detection of hepatitis B virus (HBV) DNA in serum is described that utilizes as probe a 21-nucleotide sequence 5'-d (CTTCGCTTCACCTCTGCACGT) labelled at the 3'-end with [32P]ddAMP. The oligonucleotide probe sequence occurs in all known HBV genomes and is complementary to a region near the end of the single-stranded gap. It includes the 11-nucleotide direct repeat 5'-d(TTCACCTCTGC). The method was tested on 988 serum HBsAg-positive or -negative specimens and compared to results with HBV DNA probe, with over 98% concordance between the methods. The sensitivity of the two assays was comparable. The assay was developed for testing serum samples fixed to nylon or nitrocellulose membranes. Hybridization time could be shortened to a few hours as compared to 16 h for HBV DNA probes. Immaculate backgrounds were obtained by using a hybridization medium containing polyethylene glycol, heparin and pyrophosphate, and a particular washing procedure.     

Evolution of precore/core promoter mutations in hepatitis B carriers with hepatitis B e antigen seroreversion

The evolution of precore stop codon mutation (A1896) and dinucleotide mutation (T1762/A1764) in the basic core promoter (BCP) of hepatitis B virus (HBV) genome during transient seroconversion and seroreversion of hepatitis B e antigen (HBeAg) remains unclarified. Five HBeAg-positive HBV carriers who experienced transient seroconversion followed by seroreversion of HBeAg (Group I, 3.3%) and 3 HBeAg-negative HBV carriers with documented reversion of HBeAg (Group II, 2.5%) in a prospective cohort of 272 patients with chronic hepatitis B were thus identified. The sequential changes at the precore nucleotide 1896 and BCP dinucleotide 1762/1764 were determined by polymerase chain reaction and direct sequencing. At enrollement, precore A1896 and BCP T1762/A1764 were noted in 4 (50%) and 1 (13%) of the eight patients. During a median follow-up period of 58 months (range: 31-76 months), 12 episodes of transient HBeAg seroconversion followed by seroreversion were encountered in Group I patients and 3 episodes of HBeAg seroreversion in Group II patients. Accompanying acute exacerbations were found in two-thirds of patients with either HBeAg seroconversion or seroreversion. Overall, precore nucleotide A1896 remained identical in 73% and 83% of the seroconversion and seroreversion events, respectively. BCP dinucleotide T1762/A1764 remained unchanged in 94% and 92% of the seroconversion and seroreversion events, respectively. At the end of follow-up, only one had both precore and BCP mutations. In conclusion, these data suggested that HBeAg seroreversion might be due to the lack of sustained precore and BCP mutations after HBeAg seroconversion. Although uncommon, HBeAg seroreversion can be associated with hepatitis exacerbation.     

Sustained elimination of hepatitis B virus from serum induced in a patient with chronic hepatitis B and advanced human immunodeficiency virus infection

A 48-year-old male patient was admitted with acquired immunodeficiency syndrome (stage III, Centers for Disease Control 1993) and viremic hepatitis B. Blood CD4 count was 15/l. Discontinuation of prednisolone, previously prescribed by the patient's family practitioner because of elevated liver enzymes, resulted in severe hepatitis (alanine aminotransferase > 300U/1). Administration of interferon-, (9 × 10⁶U s.c. 3 × weekly) was initiated. Serum markers of viral replication disappeared, and aminotransferase levels returned to normal within a few weeks. The patient's serum was found negative for HBsAg after 3 months. Immunohistochemical analysis of liver biopsies before and during interferon therapy showed disappearance of all hepatitis B virus antigens and a marked reduction in inflammatory activity. Hepatitis B virus seroconversion remained stable until the patient died from the syndrome 2 years later. This case shows that in spite of severe HIV-associated immune deficiency with CD4 counts constantly below 100/l, interferon- can lead to sustained serological and histological improvement of viremic hepatitis B. Previous administration and discontinuation of cortisone may have helped to reach this effect.Abbreviations HBV hepatitis B virus - HIV human immunodeficiency virus - IFN interferon Correspondence to: G. Gerken     

Detection of hepatitis B virus DNA in chronic carriers of hepatitis B surface antigen in southwestern Greece

The presence of hepatitis B virus (HBV) DNA in sera of 56 chronic carriers of hepatitis B surface antigen (HBsAg) was determined by three methods: the Abbott hybridization assay, the polymerase chain reaction (PCR) followed by gel electrophoresis and UV visualization (PCR-GE), and PCR followed by DNA enzyme immunoassay (PCR-DEIA). HBV DNA was detected in four samples positive for hepatitis Be antigen (HBeAg) by all methods used. Both PCR-GE and PCR-DEIA detected viraemia in two anti-HBe, anti-HBc IgM positive samples. In the group of 50 anti-HBe positive samples the sensitivity of the three methods was 10 %, 24 % and 32 %, respectively. PCR-GE and PCR-DEIA results correlated well with the patients' clinical status; of 20 patients with elevated ALT levels, 12 (60 %) were found to be positive in the PCR-GE and another 2 were found to be positive in the PCR-DEIA (70 %). These data indicate that PCR-DEIA is the most sensitive method for detection of HBV DNA. This method can be relatively easily applied in the clinical laboratory for monitoring the progression of disease and/or interferon therapy in patients with chronic hepatitis B.     

Different levels of hepatitis B virus replication among hepatitis Be antigen-positive chronic carriers

Detection of hepatitis B virus DNA polymerase (HBV DNA-pol) activity and of HBV DNA sequences in serum allowed to distinguish the different degrees of HBV replication in chronic HBsAg carriers. The amount of HBV DNA in the serum of 48 HBsAg and HBeAg positive patients in relation with the presence or absence of HBV DNA-pol was determined by dot-blot hybridization. The HBeAg positive cases with HBV DNA-pol activity had significantly higher HBV DNA levels than those which were DNA-pol negative (p less than 0.001). However, no significant differences with respect to liver function tests (transaminase, albumin, gammaglobulin) or to the histological diagnosis were found between both groups. Quantitative detection of serum HBV DNA in HBsAg chronic carriers may be helpful for learning the natural history of HBV infection and monitoring the antiviral therapy.     

Detection of hepatitis B virus DNA in serum by a rapid filtration-hybridization assay

A simple method for detecting hepatitis B virus DNA (HBV DNA) in serum using a filtration step for spotting sera on nitrocellulose paper followed by molecular hybridization is described. This method is rapid, sensitive, requires very small quantities of serum, and can be used for simultaneous testing of up to 96 samples in one filter apparatus. The sera tested for HBV DNA were also assayed for serological markers of HBV infection and comparison of data shows that on average 67% (30 of 45) of HBsAg- and HbeAg-positive sera contain HBV DNA, whereas 13% of HBsAg- and anti-HBe-positive sera contain HBV DNA. In general, there was a statistically significant correlation between the concentration of HBsAg in the serum and the presence or absence of HBV DNA. These results indicate that molecular hybridization is a valuable assay in addition to serological markers for identifying the possible infectivity of sera, and the simple and rapid method reported here makes the use of such hybridization technique easier.