Mucopolysaccharidosis IVA (Morquio A): identification of novel common mutations in the N-acetylgalactosamine-6-sulfate sulfatase (GALNS) gene in Italian patients

Mucopolysaccharidosis IVA (MPS IVA) is a lysosomal storage disorder caused by the deficiency of N-acetylgalactosamine-6-sulfate sulfatase (GALNS). Mutation screening of the GALNS gene was performed by RT-PCR with one amplicon and direct sequence analyses using cDNA samples from 15 Italian MPS IVA patients. Each mutation was confirmed at the genomic level. In this study, 13 different gene mutations with four common mutations (over 10% of mutant alleles) were identified in 12 severe and three milder (attenuated) MPS IVA patients. The gene alterations in 12 out of 13 were found to be point mutations and only one mutation was deletion. Ten of 13 mutations were novel. The c.1070C>T (p.Pro357Leu) mutation coexisted with c.1156C>T (p.Arg386Cys) mutation on the same allele. Together they accounted for 100% of the 30 disease alleles of the patients investigated. Four common mutations accounted for 70% of mutant alleles investigated. Urine keratan sulfate (KS) concentrations were elevated in all patients investigated. These data provide further evidence for extensive allelic heterogeneity and importance of relation among genotype, phenotype, and urine KS excretion as a biomarker in MPS IVA.     

Five novel mutations of GALNS in Korean patients with mucopolysaccharidosis IVA

Mucopolysaccharidosis IVA (MPS IVA; OMIM #253000) is caused by the deficiency of N‐acetylgalactosamine‐6‐sulfate sulfatase (GALNS), a lysosomal enzyme involved in the catabolism of keratan and chondroitin sulfate. In this study, we examined biochemical and genetic data from 6 Korean patients presenting with classic MPS IVA by measuring GALNS activity in peripheral blood leukocytes and skin fibroblasts. We initially identified Korean patients with MPS IVA by clinical, biochemical, and genetic analyses. We performed PCR‐direct sequencing to identify molecular defects of the GALNS gene in patients and assessed the mutational statuses of family members as well as 50 healthy unrelated subjects. In silico analyses were performed to check for novel mutations. The mean age of the six female patients was 8.0 ± 5.2 years (range: 2–17 years), and were all found to have severe reductions of GALNS enzyme. A total of 12 mutant alleles were identified, corresponding to 7 different mutations. Five novel mutations were c.218A>G (p.Y73C), c.451C>A (p.P151T), c.725C>G (p.S242C), c.752G>A (p.R251Q), and c.1000C>T (p.Q334X). Two other mutations were c.1156C>T (p.R386C) and c.1243‐1G>A. Two mutations, c.451C>A and c.1000C>T, accounted for 58% of all mutations in this sample. © 2013 Wiley Periodicals, Inc.     

Mutation and polymorphism spectrum of the GALNS gene in mucopolysaccharidosis IVA (Morquio A)

Mucopolysaccharidosis IVA (MPS IVA; Morquio A disease) is an autosomal-recessive disorder caused by a deficiency of lysosomal N-acetylgalactosamine-6-sulfate sulfatase (GALNS; E.C.3.1.6.4). GALNS is required to degrade glycosaminoglycans, keratan sulfate (KS), and chondroitin-6-sulfate. Accumulation of undegraded substrates in lysosomes of the affected tissues leads to a systemic bone dysplasia. We summarize information on 148 unique mutations determined to date in the GALNS gene, including 26 novel mutations (19 missense, four small deletions, one splice-site, and two insertions). This heterogeneity in GALNS gene mutations accounts for an extensive clinical variability within MPS IVA. Seven polymorphisms that cause an amino acid change, and nine silent variants in the coding region are also described. Of the analyzed mutant alleles, missense mutations accounted for 78.4%; small deletions, 9.2%; nonsense mutation, 5.0%; large deletion, 2.4%; and insertions, 1.6%. Transitional mutations at CpG dinucleotides accounted for 26.4% of all the described mutations. The importance of the relationship between methylation status and distribution of transitional mutations at CpG sites at the GALNS gene locus was elucidated. The three most frequent mutations (over 5% of all mutations) were represented by missense mutations (p.R386C, p.G301C, and p.I113F). A genotype/phenotype correlation was defined in some mutations. Missense mutations associated with a certain phenotype were studied for their effects on enzyme activity and stability, the levels of blood and urine KS, the location of mutations with regard to the tertiary structure, and the loci of the altered amino acid residues among sulfatase proteins.     

Natural history of the oldest known females with mucopolysaccharidosis type IVA (Morquio A syndrome)

Mucopolysaccharidosis Type IVA (MPS IVA), also known as Morquio A syndrome, is an autosomal recessive lysosomal storage disorder that results from variants in the GALNS gene that encodes the enzyme galactosamine‐6‐sulfate sulfatase. This syndrome has systemic manifestations including, but not limited to, musculoskeletal, respiratory, cardiovascular, rheumatologic, neurologic, dental, ophthalmologic, and otologic. This condition is usually detected within the first few years of life with an average life expectancy of 25.3 ± 17.43 years. We report the natural history of two of the oldest known females with MPS IVA, who were each clinically diagnosed at 4 years of age and who are now 74 and 70 years of age, respectively. They are both affected by pathogenic variants c.319G>A (p.Ala107Thr) and c.824 T>C (p.Leu275Pro) in the GALNS gene.     

Fourteen novel mucopolysaccharidosis IVA producing mutations in GALNS gene

Mucopolysaccharidosis IVA (MPS IVA) is an autosomal recessive disorder caused by a deficiency of the lysosomal N-acetylgalactosamine-6-sulfate sulfatase. Here, we report our analysis of data on 21 patients of diverse ethnic and geographic origins studied by SSCP and sequencing analysis. Sixteen mutations were detected, including 14 new mutations (11 missense, one premature termination, one splice site alteration, and one cryptic site alteration). The donor splice site mutation (IVS4 + 1G→A) predicts that normal splicing will be abolished and that translation would lead to an immediate premature termination (W141X). Another novel nucleotide change outside the coding sequence is an intronic alteration (IVS9-42C→T:ggtcggtgcggttggtgc) creating a potential cryptic donor site. The nucleotide sequence surrounding this alteration is highly suggestive of a consensus donor splice site. All 12 missense and nonsense mutations were shown by transient expression to abolish or greatly reduce GALNS activity, thereby providing an explanation as to why they produce MPS IVA. All mutations were readily confirmed by restriction enzyme or by allelic specific oligonucleotide analysis (ASO). These findings, coupled with previously reported mutations, bring the total of different mutations to 41 among independent families with MPS IVA, illustrating the extensive allelic heterogeneity among mutations producing MPS IVA. Hum Mutat 10:368–375, 1997. © 1997 Wiley-Liss, Inc.     

Morquio A Syndrome‐Associated Mutations: A Review of Alterations in the GALNS Gene and a New Locus‐Specific Database

Morquio A syndrome (mucopolysaccharidosis IVA) is an autosomal recessive disorder that results from deficient activity of the enzyme N‐acetylgalactosamine‐6‐sulfatase (GALNS) due to alterations in the GALNS gene, which causes major skeletal and connective tissue abnormalities and effects on multiple organ systems. The GALNS alterations associated with Morquio A are numerous and heterogeneous, and new alterations are continuously identified. To aid detection and interpretation of GALNS alterations, from previously published research, we provide a comprehensive and up‐to‐date listing of 277 unique GALNS alterations associated with Morquio A identified from 1,091 published GALNS alleles. In agreement with previous findings, most reported GALNS alterations are missense changes and even the most frequent alterations are relatively uncommon. We found that 48% of patients are assessed as homozygous for a GALNS alteration, 39% are assessed as heterozygous for two identified GALNS alterations, and in 13% of patients only one GALNS alteration is detected. We report here the creation of a locus‐specific database for the GALNS gene ( http://galns.mutdb.org/ ) that catalogs all reported alterations in GALNS to date. We highlight the challenges both in alteration detection and genotype–phenotype interpretation caused in part by the heterogeneity of GALNS alterations and provide recommendations for molecular testing of GALNS.     

Mutations and polymorphisms in N-acetylgalactosamine-6-sulfate sulfatase gene in Turkish Morquio A patients

Mucopolysaccharidosis type IVA (MPS IVA) is an autosomal recessive inherited metabolic disease resulting from deficiency of N-acetylgalactosamine-6-sulfatase (GALNS). This lysosomal storage disorder leads to a wide range of clinical variability ranging from severe, through intermediate to mild forms. The classical phenotype of Morquio A disease is characterized by severe bone dysplasia without intellectual impairment. Two severe MPS IVA patients from two unrelated Turkish families have been investigated. The 14 exons and intron-exon junctions of the GALNS gene were sequenced after amplification from genomic DNA. Direct sequencing revealed two homozygous mutations previously described: p.L390X in exon 11 and p.W141R in exon 4. The p L390X mutation was associated with four novel polymorphisms in intron 2, intron 5 and intron 6 and one polymorphism previously described in exon 7. We have analysed the haplotypes associated with the two identified mutations. These molecular findings will permit accurate carrier detection, prenatal diagnosis and counseling for Morquio A syndrome in Turkey.     

Heteroallelic missense mutations of the galactosamine-6-sulfate sulfatase (GALNS) gene in a mild form of Morquio disease (MPS IVA)

Morquio disease (MPS IVA) is an autosomal recessive disorder caused by a deficiency of N-acetylgalactosamine-6-sulfate sulfatase (GALNS) activity. Patients commonly present in early infancy with growth failure, spondyloepiphyseal dysplasia, corneal opacification, and keratan sulfaturia, but milder forms have been described. We report on a patient who grew normally until age 5 years. Her keratan sulfaturia was not detected until adolescence, and she now has changes restricted largely to the axial skeleton. She has experienced only mildly impaired vision. At age 22, thin-layer chromatography of purified glycosaminoglycans showed some keratan sulfaturia. GALNS activity in fibroblast homogenate supernatants was 20 ± 5% of controls (as compared to 5 ± 3% of controls in severe MPS IVA, P <.003). Kinetic analysis of residual fibroblast GALNS activity in patient and parents revealed decreased K_m and increased V_max in the mother and daughter, but not in the father, compatible with compound heterozygosity. GALNS exons were amplified from patient genomic DNA and screened by SSCP. Two missense mutations, a C to T transition at position 335 (predicting R94C) and a T to G transversion at position 344 (predicting F97V), were found on sequencing an abnormally migrating exon 3 amplicon. Digestion of the amplicon with FokI and AccI restriction enzymes (specific for the R94C and F97V mutations, respectively) confirmed heterozygosity. In fibroblast transfection experiments, heterozygous R94C and F97V mutants independently expressed as severe and mild GALNS deficiency, respectively. We interpret these findings to indicate that our patient bears heteroallelic GALNS missense mutations, leading to GALNS deficiency and mild MPS IVA. Our findings expand the clinical and biochemical phenotype of MPS IVA, but full delineation of the genotype-phenotype relationship requires further study of native and transfected mutant cell lines. © 1996 Wiley-Liss, Inc.     

Mucopolysaccharidosis IVA: screening and identification of mutations of the N-acetylgalactosamine-6-sulfate sulfatase gene

Mutations causing mucopolysaccharidosis IVA in 15 Japanese andone Caucasian patient were characterized. To screen these mutations,we used a combination of single strand conformation polymorphismanalysis and heteroduplex analysis for PCR products of targetedcDNA or genomic DNA. Various small mutations were identifiedin 23 of 26 alleles, while the other six alleles had large rearrangements.Cycle sequencing of PCR products revealed 15 different mutations,including 12 missense, one nonsense, one frame shift (2 bp deletion)and one splice site mutation, in accord with the broad rangeof clinical phenotypes. Two alleles have different mutationsin the same nucleotide position of exon 3 (R94C, CGC     

Biochemical and structural analysis of missense mutations in N-acetylgalactosamine-6-sulfate sulfatase causing mucopolysaccharidosis IVA phenotypes

Mucopolysaccharidosis IVA (MPS IVA; OMIM#253000), a lysosomal storage disorder caused by a deficiency of N -acetylgalactosamine-6-sulfate sulfatase (GALNS), has variable clinical phenotypes. To date we have identified 65 missense mutations in the GALNS gene from MPS IVA patients, but the correlation between genotype and phenotype has remained unclear. We studied 17 missense mutations using biochemical approaches and 32 missense mutations, using structural analyses. Fifteen missense mutations and two newly engineered active site mutations (C79S, C79T) were characterized by transient expression analysis. Mutant proteins, except for C79S and C79T, were destabilized and detected as insoluble precursor forms while the C79S and C79T mutants were of a soluble mature size. Mutants found in the severe phenotype had no activity. Mutants found in the mild phenotype had a considerable residual activity (1.3-13.3% of wild-type GALNS activity). Sulfatases, including GALNS, are members of a highly conserved gene family sharing an extensive sequence homology. Thus, a tertiary structural model of human GALNS was constructed from the X-ray crystal structure of N -acetylgalacto-samine-4-sulfatase and arylsulfatase A, using homology modeling, and 32 missense mutations were investigated. Consequently, we propose that there are at least three different reasons for the severe phenotype: (i) destruction of the hydrophobic core or modification of the packing; (ii) removal of a salt bridge to destabilize the entire conformation; (iii) modification of the active site. In contrast, mild mutations were mostly located on the surface of the GALNS protein. These studies shed further light on the genotype-phenotype correlation of MPS IVA and structure-function relationship in the sulfatase family.     

Mucopolysaccharidosis IVA within Tunisian patients: Confirmation of the two novel GALNS gene mutations

Mucopolysaccharidosis type IVA or Morquio A disease is an autosomal recessive disease resulting from a deficiency of the lysosomal enzyme N-acetylgalactosamine-6-sulfate-sulfatase, which hydrolyses N-acetylgalactosamine-6-sulfate and galactose-6-sulfate in glycosaminoglycans. Phenotypes in Morquio A disease vary from the classical form with severe bone dysplasia, heart valve involvement, corneal opacity, short trunk dwarfism and a life span of 20 to 30 years, to attenuated forms with normal life span, mild bone involvement and mild visceral organ involvement. Unlike the other forms of mucopolysaccharidoses, Morquio A disease is characterized by normal intelligence.     

Mutational spectrum of the iduronate 2 sulfatase gene in 25 unrelated Korean Hunter syndrome patients: identification of 13 novel mutations

Hunter syndrome (Mucopolysaccharidosis type II, MPS2) is an X-linked recessively inherited disease caused by a deficiency of iduronate 2 sulfatase (IDS). In this study, we investigated mutations of the IDS gene in 25 Korean Hunter syndrome patients. We identified 20 mutations, of which 13 mutations are novel; 6 small deletions (69_88delCCTCGGATCCGAAACGCAGG, 121-123delCTC, 500delA, 877_878delCA, 787delG, 1042_1049delTACAGCAA), 2 insertions (21_22insG, 683_684insC), 2 terminations (529G>T, 637A>T), and 3 missense mutations (353C>A, 779T>C, 899G>T). Moreover, using TaqI or HindIII RFLPs, we found three gene deletions. When the 20 mutations were depicted in a 3-dimensional model of IDS protein, most of the mutations were found to be at structurally critical points that could interfere with refolding of the protein, although they were located in peripheral areas. We hope that these findings will further the understanding of the underlying mechanisms associated with the disease.     

Identification of 31 novel mutations in the N-acetylgalactosamine-6-sulfatase gene reveals excessive allelic heterogeneity among patients with Morquio A syndrome

Mutation analysis of the N-acetylgalactosamine-6-sulfate sulfatase gene was performed in a group of 35 patients with mucopolysaccharidosis type IVA from 33 families, mainly of European origin. By nonradioactive SSCP screening, 35 different gene mutations were identified, 31 of them novel. Together they account for 88.6% of the disease alleles of the patients investigated. The vast majority of the gene alterations proved to be point mutations, 23 missense, 2 nonsense, and 3 affecting splicing. Six small deletions (1–27 bp) and one insertion were also characterized. In a Polish family, two mildly affected siblings were compound heterozygotes for R94G and R259Q. Their mother was homozygous for the latter point mutation, leading to enzyme deficiency and a borderline disease phenotype. Hum Mutat 10:223–232, 1997. © 1997 Wiley-Liss, Inc.     

Mucopolysaccharidosis IVA: Submicroscopic deletion of 16q24.3 and a novel R386C mutation of n-acetylgalactosamine-6-sulfate sulfatase gene in a classical Morquio disease

The N-acetylgalactosamine-6-sulfate sulfatase (GALNS) gene, which is responsible for autosomal recessive mucopolysaccharidosis IVA (MPSIVA), has been assigned to the long arm of chromosome 16, subregion 24.3, an area where the adenine phosophoribosyltransferase (APRT) gene and renal dipeptidase (DPEP I) gene are also localized. Molecular genetic studies on a severely affected patient with MPSIVA (Morquio disease), without karyotypic abnormality, revealed a partial submicroscopic deletion of 16q24.3 and a single point mutation on the other allele, with no functional GALNS activity. The patient, his mother, and siblings were hemizygous for GALNS and APRT loci, evidenced by informative RFLP and gene dosage analyses combined with a fluorescence in situ hybridization, utilizing a partial genomic clone of GALNS, but heterozygosity was retained at the DPEP I locus and proximal D16S7. Haplotyping of the family members revealed recombinational events between DPEP I locus and three other polymorphic loci on the paternal chromosome, localizing GALNS gene on the proximal side to DPEP I gene. As estimated from the genetic distance between two flanking markers of proximal D16S7 and distal DPEP I locus, size of the deletion was less than 3Mb. Mother of the boy and two older siblings were asymptomatic, despite this interstitial deletion of the Giemsa-light G band. The remaining paternal allele had no gene rearrangement but GALNS activity was not encoded as Arginine at 386 was replaced with Cysteine (R386C), suggesting this alteration accounts for the severe phenotype. Allelic loss of APRT is frequently observed in cancer tissues, thereby suggesting that the tumor suppressor gene locates near the APRT locus. No family member has evidence of any malignant disease. This study is apparently the first documentation of interstitial deletion of 16q24.3, involving GALNS and APRT genes. © 1996 Wiley-Liss, Inc.     

Molecular analysis of mucopolysaccharidosis IVA (Morquio A) in Spain

Mucopolysaccharidosis type IVA (Morquio A) is an inherited metabolic disease with autosomal recessive inheritance. The pathology is due to a deficient activity of N-acetylgalactosamine-6-sulfate-sulfatase, which is involved in the degradation of keratan sulfate and chondroitin-6-sulfate. To date more than 150 mutations have been described in the GALNS gene in different populations. The aim of this study was to analyze the mutations and polymorphisms in Spain in order to know the epidemiology of our population and also to offer genetic counseling to affected families. We found 30 mutant alleles in the 15 families analyzed completing all the genotypes. Most of the mutations that we found were missense mutations, six of which were novel: p.S74F, p.E121D, p.Y254C, p.E260K, p.T394P and p.N495Y; we also found a small deletion (c.1142delC) and a probable deep intronic mutation that causes the loss of exon 5 (c.423_566del) found in cDNA. Both mutations are described in this study for the first time. We also identified 20 polymorphisms previously reported and 2 novel ones: (c.633+222T/C and c.898+25C>G). In conclusion, we have identified the mutations responsible for Mucopolysaccharidosis IV A in Spain. We found great allelic heterogeneity, as occurs in other populations, which hinders the establishment of genotype-phenotype correlations in Spain. This study has been very useful for genetic counseling to the affected families.     

Molecular analysis of Turkish Gaucher disease patients: identification of novel mutations in glucocerebrosidase (GBA) gene

Gaucher disease (GD) is the most frequent lysosomal glycolipid storage disorder due to autosomal recessive deficiency of acid beta-glucosidase and is characterized by the accumulation of glucocerebroside. In this work we carried out molecular analysis of the glucocerebrosidase gene (GBA) in 57 unrelated patients and the alleleic frequencies of gene mutations in Turkish patients are reported. The most prevalent are L444P and N370S accounting for 42% and 30% in our patients. We identified three novel genetic alterations: two missense changes S356F, L296V that are associated with the severe phenotype of type 1 GD. 303-305delCAC was identified in a homozygous state in one patient type 1 or type 3.