Molecular limits on the size of a genetic locus in Drosophila melanogaster.

This report places outer limits on the size of the DNA region required for expression of a Drosophila gene. This region, termed the unit of expression, includes not only the structural gene but also any cis-acting sequences that modulate its activity. The locus we have chosen, Sgs-4, codes for one of the glue proteins secreted by larval Drosophila salivary glands. Cytological deficiencies have been identified that eliminate sequences on one side or the other of Sgs-4 without affecting its expression. The ends of these deficiencies have been localized accurately with respect to restriction endonuclease sites in and near the locus. These endpoints limit the Sgs-4 structural gene and essential flanking sequences to a 16- to 19-kilobase region of the X chromosome. The results also show that there is no DNA sequence rearrangement in the Sgs-4 region during development of either the polytene larval salivary glands or adult flies.     

Transformation of salivary gland secretion protein gene Sgs-4 in Drosophila: stage- and tissue-specific regulation, dosage compensation, and position effect.

The Sgs-4 gene of Drosophila melanogaster encodes one of the larval secretion proteins and is active only in salivary glands at the end of larval development. This gene lies in the X chromosome and is controlled by dosage compensation--i.e., the gene is hyperexpressed in males. Therefore, males with one X chromosome produce nearly as much Sgs-4 products as females with two X chromosomes. We used a 4.9-kilobase-pair (kb) DNA fragment containing the Sgs-4d coding region embedded in 2.6 kb of upstream sequences and 1.3 kb of downstream sequences for P-element-mediated transformation of the Sgs-4h underproducer strain Kochi-R. Sgs-4d gene expression was found in all 15 transformed lines analyzed, varying with the site of chromosomal integration. The transposed gene was subject to tissue- and stage-specific regulation. At X-chromosomal sites, the levels of gene expression were similar in both sexes, signifying dosage compensation. At autosomal sites, it was on average 1.5 times higher in males than in females. The results indicate that the transforming DNA fragment contains all sequences necessary for tissue- and stage-specific regulation and for hyperexpression in males.     

Regulation of expression of the human interferon gamma gene.

DNA fragments isolated from a genomic clone of human gamma interferon (IFN-gamma) as well as IFN-gamma cDNA were used to map potential regulatory regions of the IFN-gamma gene by DNase I-hypersensitivity analyses. In nuclei from the human T-cell line Jurkat, which can be induced to express the IFN-gamma gene, we observed a strongly hypersensitive site in the first intervening sequence that localized to the only intracistronic repeat element in the gene. DNase I mapping of Jurkat cells was compared to that of several other cell types, including B cells, macrophages, and epithelial cells. The presence of strong intronic hypersensitivity was found only in cells capable of expressing the IFN-gamma gene. No hypersensitivity was found in the 3' regions of the gene. Further, no hypersensitivity was observed when purified genomic DNA from Jurkat was analyzed, suggesting that DNA-protein interactions, and not simply DNA sequence alone, were responsible for DNase I hypersensitivity. The sequence AAGTGTAATTTTTTGAGTTTCTTTT, which is directly in the intronic hypersensitive area of IFN-gamma, is 83% homologous to a nearly identical sequence in the 5' flanking region of the interleukin 2 gene. In interleukin 2, the homologous sequence is about 300 base pairs upstream of that gene's promoter in an area of potential regulatory importance.     

HS-48 alone has no enhancement role on the expression of human alpha-globin gene cluster

To investigate the in vivo function of the newly defined DNase I hypersensitive site HS-48 on the whole human alpha-globin gene cluster, the region containing all the other known 5 hypersensitive sites HS-4 to HS-40 was deleted from a 117 kb bacterial artificial chromosome clone bearing the whole human alpha-globin gene cluster. Transgenic mice were generated from this construct. The RNase protection assays showed that with HS-48 left and all the other 5 hypersensitive sites deleted, the expression of human alpha-like globin genes was completely silenced in embryonic, fetal and adult stages in all tissues. This finding indicates that HS-48 alone has no enhancer activity on the expression of human alpha-like globin genes, and that the region of HS-4 to HS-40 already contains all the upstream cis-elements needed for regulating human alpha-like globin genes.     

Hexamethylenebisacetamide-resistant murine erythroleukemia cells have altered patterns of inducer-mediated chromatin changes.

We determined inducer-mediated changes in chromatin structure near the globin genes in a variant line of murine erythroleukemia cells (MELC). The variant cell line, R1, was derived from the inducer-sensitive DS19 cell line by selection for inducer-resistance. R1 cells are resistant to induction of erythroid differentiation by hexamethylenebisacetamide (HMBA) whereas the parental line is HMBA-sensitive. Uninduced MELC (both inducer-sensitive DS19 cells and inducer-resistant R1 cells) have DNase I-sensitive sites in chromatin containing the alpha 1- and beta maj-globin genes. These nuclease-sensitive regions are located within the beta maj-globin second intervening sequence (IVS2) and near the alpha 1-globin gene 5' cap site. Culture with HMBA causes changes in chromatin structure in both parental and variant cell lines. In DS19 cells, the DNase I-sensitive site within the beta maj-globin IVS2 becomes more resistant to nuclease cleavage, and a new DNase I-sensitive region develops near the beta maj-globin cap site. In addition, the nuclease-sensitive region adjacent to the cap site of the alpha 1-globin gene increases, and a novel 5' nuclease-sensitive site is also established. In R1 cells, HMBA-mediated changes in chromatin structure are incomplete. The DNase I-sensitive site within the beta maj-globin IVS2 becomes more resistant to nuclease cleavage, but the nuclease sensitivity near the beta maj-globin cap site does not increase to the extent observed in DS19 cells. The pattern of nuclease sensitivity near the alpha 1-globin gene is essentially unchanged after culture of R1 cells with HMBA. Thus, in R1 cells, resistance to HMBA-induced expression of globin genes is associated with failure to detect inducer-mediated changes in chromatin structure 5' to the cap site of the alpha 1- and beta maj-globin genes. These results also suggest that the increased nuclease resistance of a site in the beta maj-globin IVS2 does not depend on the establishment of a DNase I-sensitive region near the beta maj-globin gene cap site.     

Role of upstream DNase I hypersensitive sites in the regulation of human alpha globin gene expression

Erythroid-specific DNase 1 hypersensitive sites have been identified at the promoters of the human alpha-like genes and within the region from 4 to 40 kb upstream of the gene cluster. One of these sites, HS-40, has been shown previously to be the major regulator of tissue-specific alpha-globin gene expression. We have now examined the function of other hypersensitive sites by studying the expression in mouse erythroleukemia (MEL) cells of various fragments containing these sites attached to HS-40 and an alpha-globin gene. High level expression of the alpha gene was observed in all cases. When clones of MEL cells bearing a single copy of the alpha-globin gene fragments were examined, expression levels were similar to those of the endogenous mouse alpha genes and similar to MEL cells bearing beta gene constructs under the control of the beta-globin locus control region. However, there was no evidence that the additional hypersensitive sites increased the level of expression or conferred copy number dependence on the expression of a linked alpha gene in MEL cells.     

An erythroid-specific chromatin opening element reorganizes beta-globin promoter chromatin structure and augments gene expression.

In erythroid tissues the chromatin structure of the beta-globin gene locus is extensively remodeled. Changes include the formation of DNase I hypersensitive sites (HSs) over the promoters of actively expressed genes. To test the hypothesis that such "opening" of promoter chromatin structure is important for beta-globin gene expression, we placed a 101-bp erythroid-specific hypersensitive-site forming element (HSFE) from the core of LCR HS4 immediately upstream of a minimal beta-globin gene promoter. We then studied the effects of this element alone and in combination with other cis-acting elements on globin gene chromatin structure and gene expression in MEL cells and transgenic mice. Single or tandem HSFEs increased the size of the portion of the promoter accessible to DNase digestion, increased the proportion of promoters in an accessible conformation, and increased gene expression approximately 5-fold. These were equivalent to expression levels attained using a 2.8-kb microLCR construct. Inclusion of the LCR HS2 enhancer did not increase expression further. In transgenic mouse fetal liver cells the HSFE increased average expression 2.5-fold compared to the minimal promoter alone. These results indicate that a small cis-acting element is capable of remodeling local beta-globin promoter chromatin structure and producing expression similar to that seen with a microLCR construct.     

A large upstream region is not necessary for gene expression or hypersensitive site formation at the mouse beta -globin locus

Developmental expression at the beta-globin locus is regulated in part by the locus control region, a region upstream of the genes containing at least five major DNase I hypersensitive sites (HSs) in mammalian erythrocytes. Sequences farther 5' of these HSs are conserved in mouse and human, and both loci are embedded within a cluster of functional odorant receptor genes. In humans, distant upstream sequences have been implicated in regulation of the beta-globin genes. In this study, the role of the 5'-most HSs and their adjacent sequence was investigated by deletion of an 11-kb region from the mouse locus, including 5'HS 4.2, 5'HS 5, 5'HS 6, and the 5'beta1 odorant receptor gene. Mice that were homozygous for this deletion were fully viable, and no significant effect on adult beta-globin gene expression was seen. 5'HSs 1-4, which are located downstream of the deletion, were still present in the mutant mice. In addition, two new upstream HSs, HS -60.7 and HS -62.5, were found in erythroid tissue of both wild-type and mutant mice. Therefore, although the possibility of a minor role still exists, neither the HSs nor the other regions deleted in this study are essential for beta-globin gene expression, and it is unlikely that chromatin structure is affected either upstream or downstream of the deletion. This is the largest deletion at the mouse locus control region to show no apparent phenotype, and focuses attention on the possible contribution of sequences even farther upstream.     

Changes of DNA methylation and chromatin structure in the human myeloperoxidase gene during myeloid differentiation.

Expression of the myeloperoxidase (MPO) gene is tightly regulated in a tissue- and development-specific manner. Accumulation of MPO messenger RNA (mRNA) occurs only at the late myeloblastic and promyelocytic stages of myeloid differentiation and is negligible at other stages of myeloid development and in other tissues. The goal of our studies was to begin to understand the events that occur to control MPO gene expression during normal granulocytopoiesis. Chromatin structure of the MPO gene was evaluated by DNase I treatment of isolated nuclei and Southern blot analysis. No detectable DNase I hypersensitive sites were found in the region of the MPO gene in non-myeloid cells. One site was present in the 5' upstream region in myeloid cells that are developmentally too immature to transcribe MPO. Three sites of hypersensitivity in the regions of the putative MPO promoter and upstream region occurred in MPO-expressing promyelocytes. These sites were markedly reduced in terminally differentiated, non-expressing myeloid cells. Analysis of DNA methylation of the MPO gene using methylation-sensitive restriction enzymes showed that the gene was highly methylated in non-myeloid cells. Stepwise demethylation occurred in myeloid cells developmentally too immature to transcribe MPO. Maximal demethylation in the 5' gene region occurred in MPO-expressing promyelocytes. This methylation pattern did not change in terminally differentiated, MPO non-expressing myeloid cells. A somatic hybrid cell formed by fusion of HL-60 (MPO-expressing cells) and PUT (MPO non-expressing lymphoid cells) extinguished expression of MPO and showed a chimeric pattern of MPO gene methylation, suggesting that demethylation is necessary but not sufficient for expression of the MPO gene. Our studies show that demethylation and DNase I hypersensitivity of the MPO gene were associated with a tissue-dependent potential for MPO gene expression that preceded the developmental ability to express MPO mRNA.     

Characterization of the DNase I hypersensitive site 3' of the human beta globin gene domain

The members of the human beta globin gene family are flanked by strong DNase I hypersensitive sites. The collection of sites 5' to the epsilon globin gene is able to confer high levels of expression of linked globin genes, but a function has not been assigned to the site 3' to the beta globin gene (3'HS1). Our analysis of this DNase I super hypersensitive site shows that the region is composed of multiple DNase I sites. By examination of the DNA sequence, we have determined that the region is very A/T-rich and contains topoisomerase II recognition sequences, as well as several consensus binding motifs for GATA-1 and AP-1/NF-E2. Gel mobility shift assays indicate that the region can interact in vitro with GATA-1 and AP-1/NF-E2, and functional studies show that the region serves as a scaffold attachment region in both erythroid and nonerythroid cell lines. Whereas many of the physical features of 3'HS1 are shared by 5'HS2 (a component of the 5' locus control region), transient expression studies show that 3' HS1 does not share the erythroid-specific enhancer activity exhibited by 5'HS2.