Anti-hyperuricemic and nephroprotective effects of Modified Simiao Decoction in hyperuricemic mice

Ethnopharmacological relevance

Modified Simiao Decoction (MSD), based on clinical experience, has been used for decades and famous for its efficiency in treating hyperuricemic and gouty diseases.

Aim of the study

To investigate the effects of MSD on anti-hyperuricemic and nephroprotective effects are involved in potassium oxonate-induced hyperuricemic mice.

Materials and methods

The effects of MSD were investigated in hyperuricemic mice induced by potassium oxonate. MSD were fed to hyperuricemic mice daily at a dose of 0.45, 0.90, 1.80 g/kg for 10 days, and allopurinol (5 mg/kg) was given as a positive control. Serum and urine levels of uric acid and creatinine, and fractional excretion of uric acid (FEUA) were determined by colorimetric method. Its nephroprotective effects were evaluated by determining a panel of oxidative stress markers after the intervention in hyperuricemic mice. Simultaneously, protein levels of urate transporter 1 (URAT1) and organic anion transporter 1 (OAT1) in the kidney were analyzed by Western blotting.

Results

MSD could inhibit XOD activities in serum and liver, decrease levels of serum uric acid, serum creatinine and BUN, and increased levels of urine uric acid, urine creatinine, FEUA dose-dependently through down-regulation of URAT1 and up-regulation of OAT1 protein expressions in the renal tissue of hyperuricemic mice. It also effectively reversed oxonate-induced alterations on renal MDA levels and SOD activities in this model.

Conclusion

MSD processes uricosuric and nephroprotective actions by regulating renal urate transporters and enhancing antioxidant enzymes activities to improve renal dysfunction in hyperuricemic mice.     

Study on the correlation between constituents detected in serum from Rhizoma Smilacis Glabrae and the reduction of uric acid levels in hyperuricemia

Ethnopharmacological relevance

Rhizoma Smilacis Glabrae (RSG) has been used in the clinical treatment of gout and hyperuricemia in China for thousands of years. Modern pharmacological studies have shown that RSG exhibits hypouricemic effects because of its significant inhibitory effect on the activity of xanthine oxidase.

Materials and methods

The Rhizoma Smilacis Glabrae extract (RSGE) at 1 mL/100 g oral administration was demonstrated to possess in vivo potent hypouricemic effects in hyperuricemic rats pretreated with oxonic acid potassium salt (200 mg/kg, 2 mL/kg). UPLC–MS was used to identify the constituents absorbed in the serum. In addition, a bivariate correlation analysis between the changes in the relative contents of the constituents from RSGE detected by HPLC and the serum uric acid levels in hyperuricemic rats at different points in time was used to calculate their correlation coefficients.

Results

A total of 14 constituents were observed in the RSGE-treated rat serum, and 11 of these were inferred. An RSGE constituent was considered correlated with the hypouricemic effects if its correlation coefficient was above 0.5. The results suggested that only seven of the constituents absorbed in the serum of the hyperuricemic rats were correlated with hypouricemic effects, namely, palmitic acid, 3′-O-methyltaxifolin glucuronide, 3′-O-methyiastilbin glucuronide, astilbin glucuronide, 5-O-caffeoylshikimic acid glucuronide, resveratrol glucuronide, and dihydrokaempferol.

Conclusion

These findings provide potent evidence for the study on RSG as a pharmacodynamic material basis and for developing RSG as a safe and promising natural drug to prevent hyperuricemia and gout instead of allopurinol.     

Anti-hyperalgesic activity of corilagin,a tannin isolated from Phyllanthus niruri L. (Euphorbiaceae)

Ethnopharmacological relevance

Corilagin (β-1-O-galloyl-3,6-(R)-hexahydroxydiphenoyl-d-glucose) is a tannin isolated from Phyllanthus niruri (Euphorbiaceae). This plant is well known for their therapeutic purposes to treat several diseases associated with dolorous process and are used in several ethno-medicines in tropical and subtropical countries.

Aim of the study

This study was designed to evaluate the anti-hyperalgesic activity of corilagin using chemically and thermally based nociception models in mice.

Materials and methods

Corilagin was isolated from Phyllanthus niruri (Euphorbiaceae) by extraction and chromatographic procedures and the anti-hyperalgesic activity was evaluated by using writhing, formalin, capsaicin, glutamate and hot plate tests in mice.

Results

Corilagin presented activity in acetic acid model with the ID₅₀ calculated value of 6.46 (3.09–13.51) being about 20.6 fold more potent than acetylsalicylic acid. It also exhibited activity against the first phase of formalin test with ID₅₀ value of 18.38 (15.15–22.59) μmol/kg. In the capsaicin and glutamate models, corilagin demonstrated significant activity at the 3 mg/kg.

Conclusion

The experimental data demonstrated that corilagin exhibits anti-hyperalgesic activity that may be due to interaction with the glutamatergic system.     

Pharmacological basis for use of Lychnophora trichocarpha in gouty arthritis: anti-hyperuricemic and anti-inflammatory effects of its extract, fraction and constituents

Ethnopharmacological relevance

The ethanolic extract of Lychnophora trichocarpha Spreng. is used in Brazilian folk medicine to treat bruise, pain and inflammatory diseases.

Aim of the study

The present study aimed at investigating whether ethanolic extract of L. trichocarpha, its ethyl acetate fraction and its main bioactive compounds could be useful to treat gouty arthritis by countering hyperuricemia and inflammation.

Materials and methods

L. trichocarpha ethanolic extract (LTE), ethyl acetate fraction from ethanolic extract (LTA) and isolated compounds were evaluated for urate-lowering activity and liver xanthine oxidase (XOD) inhibition in oxonate-induced hyperuricemic mice. Anti-inflammatory activity in monosodium urate crystal-induced paw oedema, an experimental model of gouty arthritis, was also investigated.

Results

Crude ethanolic extract and its ethyl acetate fraction showed significant urate-lowering effects. LTE was also able to significantly inhibit liver xantine oxidase (XOD) activity in vivo at the dose of 250 mg/kg. Luteolin, apigenin, lupeol, lychnopholide and eremantholide C showed the anti-hyperuricemic activities among tested compounds. Apigenin also showed XOD inhibitory activity in vivo. Luteolin, lychnopholide, lupeol and eremantholide C, in turn, did not shown significant inhibitory activity towards this enzyme, indicating that this mechanism is not likely to be involved in urate-lowering effects of those compounds. LTE, LTA, lupeol, β-sitosterol, lychnopholide, eremantholide, luteolin and apigenin were also found to inhibit monosodium urate crystals-induced paw oedema in mice.

Conclusions

Ethanolic extract of Lychnophora trichocarpha and some of its bioactive compounds may be promising agents for the treatment of gouty arthritis since they possesses both anti-hiperuricemic and anti-inflammatory properties.     

The dual actions of Sanmiao wan as a hypouricemic agent: Down-regulation of hepatic XOD and renal mURAT1 in hyperuricemic mice

Ethnopharmacological relevance

Sanmiao wan (SMW) is widely used for the treatment of gout and hyperuricemia in traditional Chinese medicine.

Aim of the study

The aim of the present study was to investigate the hypouricemic effects of SMW and its possible mechanism in potassium oxonate-induced hyperuricemic mice.

Materials and methods

SMW at 489, 978 and 1956 mg/kg was orally administered to hyperuricemic and normal mice, and standard drug allopurinol (2.5 mg/kg) was served as a positive control. The effects of SMW on serum, urine and liver levels of uric acid, serum levels of creatinine, and activity of hepatic xanthine oxidase (XOD) were measured in mice. Moreover, the effects of SMW on the mRNA and protein levels of hepatic XOD and renal urate transporter 1 (mURAT1) in mice were analyzed by semi-quantitative RT-PCR and Western blotting methods, respectively.

Results

SMW significantly reduced uric acid levels in serum and liver, inhibited hepatic XOD activity, mRNA and protein levels in hyperuricemic mice. Furthermore, SMW could effectively down-regulate renal mURAT1 mRNA and protein levels of hyperuricemic mice. And it reversed oxonate-induced elevation in serum creatinine levels of mice. However, SMW did not show any effects in normal mice.

Conclusion

These findings suggested that SMW produced dual hypouricemic actions by suppressing hepatic XOD to reduce uric acid production and down-regulating renal mURAT1 to decrease urate reabsorption and enhance urate excretion in hyperuricemic mice.     

Effects of Phyllanthus urinaria extract on HepG2 cell viability and oxidative phosphorylation by isolated rat liver mitochondria

Ethnopharmacological relevance

Phyllanthus urinaria is widely used as anti-inflammatory, anti-diarrheal and hepatoprotective medicines in Asian countries such as India, China and Thailand. In Thailand, Phyllanthus urinaria is traditionally used as an adjuvant or alternative medicine for cancer patients, including liver cancer. However, there is limited scientific evidence supporting its use in cancer particularly hepatocellular carcinoma.

Aim of the study

To investigate the cytotoxic effect of Phyllanthus urinaria extract on human hepatocellular carcinoma HepG2 cells and the effect on oxidative phosphorylation by isolated rat liver mitochondria.

Materials and methods

HepG2 cells and isolated rat liver mitochondria were treated with the 50% methanolic extract of Phyllanthus urinaria. Cytotoxicity of the extract was assessed by trypan blue exclusion and MTT assay. Rates of oxygen consumption of isolated mitochondria were determined with a Clark oxygen electrode.

Results

It was found that the hydromethanolic extract induced cell death of HepG2 cells in a dose-dependent fashion. The IC₅₀ of Phyllanthus urinaria extract measured by trypan blue exclusion and MTT assay were 431 ± 65 μg/ml and 445 ± 62 μg/ml, respectively. Morphological changes of the cells were also observed. With isolated rat liver mitochondria, the extract slightly stimulated mitochondrial state 4 respiration but profoundly depressed state 3 respiration and respiratory control ratio.

Conclusions

The extract impairs energy metabolism by acting as inhibitor of oxidative phosphorylation and weak mitochondrial uncoupler. These mitochondrial effects may play a role in the cytotoxic action of Phyllanthus urinaria extract on HepG2 cells. These results provide preliminary experimental evidence supporting the use of Phyllanthus urinaria against hepatocellular carcinoma and open the possibility of considering this plant an adjunctive medicine for the treatment of this deadly disease.     

In vitro xanthine oxidase inhibitory activity of the fractions of Erythrina stricta Roxb.

Aim of the study

To assay the in vitro xanthine oxidase inhibitory activity of the various fractions of the hydromethanolic extract of the leaves of Erythrina stricta and to determine its enzyme inhibition mechanism.

Materials and methods

Xanthine oxidase inhibitory activity was assayed spectrophotometrically under aerobic conditions and the degree of enzyme inhibition was determined by measuring the increase in absorbance at 295 nm associated with uric acid formation. Enzyme kinetics was carried out using Lineweaver-Burk plots using xanthine as the substrate.

Results

Among the fractions tested, the chloroform fraction exhibited highest potency (IC₅₀ 21.2 ± 1.6 μg/ml) followed by the pet–ether (IC₅₀ 30.2 ± 2.2 μg/ml), ethyl acetate (IC₅₀ 44.9 ± 1.4 μg/ml) and residual (IC₅₀ 100 ± 3.3 μg/ml) fractions. The IC₅₀ value of allopurinol used, as the standard was 6.1 ± 0.3 μg/ml. Enzyme inhibition mechanism indicated that the mode of inhibition was of a mixed type.

Conclusion

These results suggest that the use of Erythrina stricta for the treatment of gout could be attributed to its xanthine oxidase inhibitory activity.     

Protective activity of phyllanthin in ethanol-treated primary culture of rat hepatocytes

Aim of the study

To investigate the protective effect of phyllanthin (a known principal constituent of Phyllanthus amarus Schum. et Thonn.) on ethanol-induced rat liver cell injury.

Materials and methods

Primary culture of rat hepatocytes (24 h culturing) were pretreated with phyllanthin (1, 2, 3 and 4 μg/ml) for 24 h. After 24 h pretreatment, cells were treated with ethanol (80 μl/ml) for 2 h.

Results

Ethanol decreased %MTT, increased the release of transaminases (ALT and AST) with the increase in the production of intracellular ROS and lipid peroxidation. Phyllanthin demonstrated its role in protection by antagonizing the above effect induced by ethanol. Phyllanthin also restored the antioxidant capability of rat hepatocytes including level of total glutathione, and activities of superoxide dismutase (SOD) and glutathione reductase (GR) which were reduced by ethanol.

Conclusions

These results suggested the hepatoprotective effect of phyllanthin against ethanol-induced oxidative stress causing rat liver cell damage through its antioxidant activity.     

Ethnopharmacology guided screening of traditional Indian herbs for selective inhibition of Plasmodium specific lactate dehydrogenase

Ethnopharmacological relevance

Medicinal plants traditionally used to treat malaria can provide quality leads towards identifying novel anti-malarial drugs. Here we combined this approach with target based drug discovery and explored Plasmodium specific lactate dehydrogenase (LDH) inhibitory activity of 8 Indian plants which are ethnically used to treat malaria.

Methods

LDH from Indian Plasmodium falciparum and Plasmodium vivax strains, were cloned and expressed in Escherichia coli, followed by purification of recombinant enzymes (rPfLDH and rPvLDH respectively). Extracts of 8 plants in different organic and aqueous solvents, were screened for their inhibitory activity on rPfLDH, rPvLDH and mammalian LDHs. Phyllanthus amarus aqueous extract was further tested for in vitro parasiticidal activity.

Results

Aqueous extract of Phyllanthus amarus Schum. and Thonn. and chloroform extract of Murraya koenigii (L.) Spreng. exhibited profound and exclusive inhibitory effect on Plasmodium falciparum LDH (IC₅₀=11.2 μg/ml±0.4) and Plasmodium vivax LDH (IC₅₀=6.0 μg/ml±0.6) respectively. Moreover, Phyllanthus amarus aqueous extract also demonstrated antiplasmodial activity in vitro, on Chloroquine sensitive and resistant strains of Plasmodium falciparum (IC₅₀=7.1 μg/ml±0.5 and 6.9 μg/ml±0.7 respectively).

Conclusion

Target specific screening of traditional herbs used in malaria treatment has proffered Phyllanthus amarus and Murraya koenigii extracts as hits which can optimistically provide novel antimalarial drugs.     

Gender-dependent pharmacokinetics of lignans in rats after single and multiple oral administration of Schisandra chinensis extract

Ethnopharmacological relevance

Schisandra chinensis (S. chinensis), a traditional Chinese medicine, has been widely used as sedatives and tonics in clinic. Schisandra lignans are believed to be the major bioactive components in S. chinensis. However, there is a lack of information about the effects of gender and repeated-dose on the pharmacokinetic properties of the schisandra lignans.

Aim of the study

The study was performed to investigate the influence of gender on the pharmacokinetics of schisandra lignans after administration of S. chinensis extract and to compare their pharmacokinetic behaviors between single and multiple administration.

Materials and methods

Two groups of rats (half male and half female) were received a single dose or multiple doses of S. chinensis extract, respectively. A liquid chromatography–tandem mass spectrometry method was developed and validated to determine the plasma concentrations of schisandra lignans.

Results

The pharmacokinetic parameters of schisandrin, schisandrol B, deoxyschisandrin, γ-schisandrin and schisantherin A were significantly different by gender difference. The t_1/2 of all the tested schisandra lignans in female rats were 2–9 times longer than the corresponding values in male rats. The C_max and AUC_0−t of these schisandra lignans except schisantherin A in female rats were 5–50 times higher than those in male rats. The pharmacokinetic profiles of schisandrin, schisandrol B, deoxyschisandrin and schisantherin A in both gender rats after multiple doses were similar to the corresponding profile after single dose.

Conclusion

All the tested schisandra lignans showed slower elimination and higher bioavailability in female rats after single or multiple administration of S. chinensis extract compared with male rats. Their pharmacokinetic profiles were not affected by repeated-dose except γ-schisandrin, which was eliminated more slowly in female rats after multiple administration.     

Suppression of lipopolysaccharide-induced inflammatory responses in RAW 264.7 murine macrophages by aqueous extract of Clinopodium vulgare L. (Lamiaceae)

Ethnopharmacological relevance

The wild basil Clinopodium vulgare L. is commonly used in Bulgarian folk medicine for treatment of irritated skin, mastitis- and prostatitis-related swelling, as well as for some disorders accompanied with significant degree of inflammation (e.g. gastric ulcers, diabetes, and cancer).

Aim of study

To determine the effect of aqueous extract of Clinopodium vulgare L. on LPS-induced inflammatory responses of murine RAW 264.7 macrophages.

Materials and methods

Cell cytotoxicity was evaluated by MTT assay. Protein expression levels were monitored by Western blot analysis. Production of NO and PGE₂ was measured by the Griess colorimetric method and enzyme immunoassay, respectively. Activation of MMP-9 was visualized by gelatin zymography. Cytokine levels were determined by BioPlex assay. Intracellular ROS and free radical scavenging potential were measured by DCFH-DA and DPPH method, respectively. Xanthine oxidase activity was evaluated spectrophotometrically.

Results

The extract suppresses NF-κB activation by preventing Iκ-B phosphorylation and inhibits the phosphorylation of p38 and SAPK/JNK MAPKs. It down-regulates iNOS expression which manifests as a drastic decrease of NO production, inhibits MMP-9 activation, but does not affect COX-2 protein levels and reduces only slightly the released PGE₂. Secretion of IL-1β and Il-10 is greatly reduced, whereas suppression of TNF-α and GM-CSF production is less dramatic. The extract has strong free radical scavenging properties and exerts inhibitory effect on xanthine oxidase activity, which lowers the levels of intracellular ROS.

Conclusion

The study provides evidence for the anti-inflammatory potential of Clinopodium vulgare L. aqueous extract.     

Genotoxic and antigenotoxic properties of Baccharis trimera in mice

Ethnopharmacological relevance

Baccharis trimera (Less.) (Asteraceae) is a native plant from Brazil. Also known as “carqueja”, it is popularly used to treat liver diseases, diabetes, as well as digestive disorders, mainly by women with lower socioeconomic status.

Aim of the study

The aim of the present study was to investigate the in vivo genotoxic/antigenotoxic and mutagenic potential of this plant, using the comet and the micronucleus assays.

Material and methods

Female adult mice were treated with 500, 1000 or 2000 mg/kg of B. trimera aqueous extract (Bt-AE) by gavage for three consecutive days.

Results

Independently of the dose, no genotoxic effect was observed in blood and liver samples analyzed by the comet assay. Conversely, B. trimera showed an antigenotoxic effect in blood from treated mice, thus protecting cells against oxidative DNA damage induced by the ex vivo treatment with hydrogen peroxide. In addition, Bt-AE showed in vitro antioxidant activity, assessed by DPPH and xanthine oxidase assays, suggesting that the observed antigenotoxic effects might be related to its antioxidant properties.

Conclusions

However, the extract increased the frequency of micronucleus in bone marrow of treated mice, indicating a chromosomal mutagenic activity. Thus, medicines prepared from this plant should be used with caution, although the results also suggest antigenotoxic effects for B. trimera aqueous extract.     

Anti-urolithiatic effects of Punica granatum in male rats

Ethnopharmacological relevance

The traditional use of Punica granatum has been reported to regulate urine discharge and controls the burning sensation of urine.

Materials and methods

Animals model of calcium oxalate urolithiasis was developed in male rats by adding ethylene glycol 0.75% in drinking water. The Punica granatum chloroform extract (PGCE) and Punica grantum methanol extract (PGME) orally at 100, 200 and 400 mg/kg, respectively, were administered along with ethylene glycol for 28 days. On 28 day, 24 h urine was collected from individual rats and used for estimation of urine calcium, phosphate and oxalate. The serum creatinine, urea and uric acid levels were estimated in each animal. The kidney homogenate was used for the estimation of renal oxalate contents. The paraffin kidney sections were prepared to observe the CaOx deposits.

Results

The ethylene glycol control (Gr.-II) had significant (P < 0.001 vs. normal) increase in levels of urine oxalate, calcium and phosphate, serum creatinine, urea and uric acid and renal tissues oxalates, as compared to normal (Gr.-I). The paraffin kidney sections show significant histopathological changes. The treatment of PGCE and PGME at 100, 200 and 400 mg/kg doses, significantly (P < 0.001 vs. control) decreased the urine oxalate, calcium and phosphate, renal tissue oxalates and serum creatinine, urea and uric acid, in EG induced urolithiasis after 28 days.

Conclusions

The PGCE and PGME at the doses of 400 mg/kg, found to be more effective in decreasing the urolithiasis and regeneration of renal tissues in male rats.     

Evaluation of anti-tussive activity of Chamaedorea tepejilote

Aim of the study

Evaluate the potential inhibition of cough in a mouse model induced by sulfur dioxide gas of methanol and chloroform extracts of aerial parts of Chamaedorea tepejilote.

Material and methods

The antitussive effect was examined using the Ogyhara method. The extracts and theobromine were orally administered to mice. Each extract was administered to one group (400 mg/Kg) and theobromine (2 mg), and negative control received PVP. The frequency of cough was measured at 60, 90 min after the administration of chloroform extract.

Results

The water extract of C. tepejilote had no effect on the pharmacological model used in this study. The effects of the methanol and chloroform extracts of this plant on sulfur-dioxide-induced cough in experimental animals show activity dose-dependently in the range between 100 to 500 mg/Kg. At doses of 400 mg/kg, the methanol and chloroform extracts inhibited cough by 41.72% and 49.1%, respectively; these results are comparable to the effect produced by the antitussive agent theobromine (53.4% inhibition).

Conclusions

Both extracts exhibited significant antitussive activity, and the effect of the chloroform extract was dose dependent. The antitussive activity of this extract was comparable to that of theobromine. The effect of chloroform extract on the trachea was also tested; it did not relax pre-contractions in guinea pig trachealis induced KCl, carbachol or histamine.     

The traditional Hungarian medicinal plant Centaurea sadleriana Janka accelerates wound healing in rats

Ethnopharmacological relevance

The aerial parts of Centaurea sadleriana Janka, a species native to Hungary, have been used for the healing of wounds of livestock in Hungarian folk medicine. This is the first report of the ethnomedicinal use of this plant.

Aim of the study

This study was aimed at investigating the wound-healing efficiency of different extracts of Centaurea sadleriana.

Materials and methods

Experimental wounds inflicted on healthy rats by means of a branding iron were treated topically with different extracts and fractions of extracts of the aerial parts of Centaurea sadleriana. To assess the effectiveness of treatment, an absolute control (no treatment), a vehicle control (Carbomer gel) and a positive control group (1% salicylic acid in Carbomer gel) were applied.

Results

The n-hexane fraction of the methanol extract significantly accelerated the wound-healing process. This effect was rather similar to that of the positive control gel. Other fractions exhibited more moderate activities.

Conclusions

The apolar fraction of the methanol extract of Centaurea sadleriana facilitated wound healing significantly, corroborating the folk medicinal use of this plant.     

Assessing species admixtures in raw drug trade of Phyllanthus, a hepato-protective plant using molecular tools

Ethnopharmacological relevance

Phyllanthus (Euphorbiaceae) species are well known for their hepato-protective activity and are used in several ethno-medicines in indigenous health care systems in India.

Aim of the study

To assess species admixtures in raw drug trade of Phyllanthus using morphological and DNA barcoding tools.

Materials and methods

Samples of Phyllanthus used in raw drug trade were obtained from 25 shops in southern India. Species admixtures in the samples were assessed by identifying species using morpho-taxonomic keys. These identities were further validated by developing species specific DNA barcode signatures using the chloroplast DNA region, psbA-trnH. DNA from the market samples were extracted and amplified using the forward (psbAF – GTTATGCATGAACGTAATGCTC) and reverse primer (trnHR – CGCGCATGGTGGATTCACAAATC). The amplified products were sequenced at Chromous Biotech India, Bangalore. The sequences were manually edited using Chromas Lite. Species identities were established by constructing a neighbor-joining tree using MEGA V 4.0.

Results

Morphological analysis of market samples revealed six different species of Phyllanthus in the trade samples. Seventy-six percent of the market samples contained Phyllanthus amarus as the predominant species (>95%) and thus were devoid of admixtures. The remaining 24% of the shops had five different species of Phyllanthus namely Phyllanthus debilis, Phyllanthus fraternus, Phyllanthus urinaria, Phyllanthus maderaspatensis, and Phyllanthus kozhikodianus. All identities, except those for Phyllanthus fraternus, were further confirmed by the species specific DNA barcode using chloroplast region psbA-trnH.

Conclusion

Our results show that market samples of Phyllanthus sold in southern India contain at least six different species, though among them, Phyllanthus amarus is predominant. DNA barcode, psbA-trnH region of the chloroplast can effectively discriminate Phyllanthus species and hence can be used to resolve species admixtures in the raw drug trade of Phyllanthus.     

Xanthine oxidase inhibitory properties of Czech medicinal plants

Aim of the study

To investigate in vitro xanthine oxidase inhibitory properties of plants traditionally used in Czech Republic and Central-East Europe region for gout, arthritis or rheumatism treatment.

Materials and methods

Methylene chloride-methanolic and two ethanolic extracts of 27 plant species were screened for in vitro xanthine oxidase inhibitory activity using a spectrophotometric method.

Results

Around 50% of the species exhibited some degree of xanthine oxidase inhibitory properties at 200 μg/mL, showing a moderate correlation (r = 0.59) with total phenol content. The most active were methylene chloride-methanolic extracts of Populus nigra and Betula pendula, with IC₅₀ of 8.3 and 25.9 μg/mL, respectively, followed by 80% ethanolic extract of Caryophyllus aromaticus and Hypericum perforatum, both under 50 μg/mL.

Conclusions

Populus nigra and Betula pendula were identified as species with the highest xanthine oxidase inhibitory potential in our study. This correlates with the ethnobotanical data on their use in Central European folklore and provides the basis for further investigation on these plants.