Specificity of IS6110-based amplification assays for Mycobacterium tuberculosis complex.

The specificity of IS6110 for the Mycobacterium tuberculosis complex has recently been questioned. We observed no cross-reaction with 27 nontuberculous mycobacteria using strand displacement- and PCR-based amplification of the nucleotide 970 to 1026 and 762 to 865 regions of IS6110. These data support use of selected regions of IS6110 as M. tuberculosis complex-specific targets.     

Detection of 123 bp fragment of insertion element IS6110 Mycobacterium tuberculosis for diagnosis of extrapulmonary tuberculosis

Purpose: Extrapulmonary tuberculosis (EPTB) is emerging problem in developing and developed countries. The diagnosis of EPTB in its different clinical presentations remains a true challenge. IS6110-based polymerase chain reaction (PCR) is used for rapid identification and positivity rate of the Mycobacterium tuberculosis complex in clinical isolates of different sites of EPTB. The present study was carried out to study the prevalence of M. tuberculosis complex in clinical isolates of EPTB at tertiary care centres in Lucknow. Materials and Methods: Seven hundred fifty-six specimens were collected from the suspected cases of EPTB which were processed for Mycobacteria by Ziehl Neelson (ZN) staining and BACTEC culture. All the specimens were also processed for IS6110-based PCR amplification with primers targeting 123 bp fragment of insertion element IS6110 of the M. tuberculosis complex. Results: Of these 756 specimens, 71(9.3%) were positive for acid fast bacilli (AFB) by ZN staining, 227(30.1%) were positive for mycobacteria by BACTEC culture and IS6110 PCR were positive for M. tuberculosis complex in 165 (20.7%) isolates. We found a significant difference in sensitivities of different tests (P<0.05). Conclusions: This study reveals the positivity of M. tuberculosis complex in clinical isolates of EPTB case in tertiary care hospitals in Northern India. 72.7% of M. tuberculosis complex was confirmed by IS6110-PCR in culture isolates from different sites of EPTB. The high prevalence of the M. tuberculosis complex was seen in lymph node aspirate and synovial fluid. However, utility of PCR may play a potentially significant role in strengthening the diagnosis of EPTB especially targeting IS6110.     

PCR amplification of the IS6110 insertion element of Mycobacterium tuberculosis in fecal samples from patients with intestinal tuberculosis

PCR amplification of insertion element IS6110 of Mycobacterium tuberculosis in fecal samples was evaluated in the diagnosis of intestinal tuberculosis (ITB). The numbers of samples that tested positive by PCR with SalI digestion were 16/18 untreated-ITB samples, 0/8 treated-ITB samples, 12/14 smear-positive pulmonary tuberculosis samples, and 0/30 control samples. The sensitivity, specificity, positive predictive value, and negative predictive value of fecal PCR were 88.8%, 100%, 100%, and 93.7%, respectively.     

Heminested inverse PCR for IS6110 fingerprinting of Mycobacterium tuberculosis strains.

A heminested inverse PCR (HIP) for the amplification of sequences flanking the Mycobacterium tuberculosis insertion sequence IS6110 has been developed. The method depends upon primers that anneal to IS6110 at sites between its 5' end and the closest BsrFI site. The accuracy of HIP was demonstrated by the amplification of sequences within plasmid constructs carrying one or two copies of the insertion sequence IS986 in different orientations. The identities of the amplicons produced from strains carrying a single copy of IS6110 were verified by nucleotide sequencing. Analyses of 204 M. tuberculosis strains including those involved in outbreaks showed that IS6110 HIP is highly discriminatory and reproducible. HIP fingerprinting of these 204 strains generated 136 distinct types, and its discriminatory power was equivalent to that of standard restriction fragment length polymorphism analysis. The method is therefore of value for the rapid fingerprinting of M. tuberculosis strains for epidemiological purposes.     

Novel Hot Spot of IS6110 Insertion in Mycobacterium tuberculosis

We describe a hot spot for the insertion of IS6110 in Mycobacterium tuberculosis located in the area of region of difference 724 (RD724). Because RD724 defines sublineage 724 of M. tuberculosis, caution must be exercised when screening for RD724, as different polymorphisms can be observed in this region.IS6110 is a genomic insertion element containing 1,361 bp that is found only in organisms of the Mycobacterium tuberculosis complex (20). Like other members of the IS3 family, IS6110 contains two partially overlapping reading frames, orfA and orfB, that encode a transposase (6) allowing the insertion of IS6110 at multiple sites. M. tuberculosis has been shown to contain between 0 and 25 copies of this element (12). The number of copies of IS6110 and the molecular weights of the DNA fragments in which the insertions are found provide a genotyping method known as IS6110-based restriction fragment length polymorphism (RFLP) that is widely used to study the transmission dynamics of M. tuberculosis (11, 19). Although IS6110 does not have a known target for insertion, it is believed that there are hot spots of IS6110 insertion in the genome (13). Hot spots are areas of the genome where IS6110 insertions have been identified in more than one isolate. Several hot spots for IS6110 insertion have been described, including the plcD region (23), IS1547 (4), the direct repeat locus (7), and PPE genes (25). The presence of these hot spots supports the contention that IS6110 is not randomly distributed in the genome. This is important, as IS6110 RFLP typing is based on the premises that IS6110 is integrated into the genome randomly and that the discriminatory power of the technique increases in proportion to the number of IS6110 copies. Therefore, ideally, IS6110 bands integrated in hot spots should be removed when calculating similarity indexes among isolates, although in practice, it is difficult to determine which bands are inserted in hot spots (13).Another source of genetic polymorphisms in M. tuberculosis is the insertion and deletion of genomic segments known as large sequence polymorphisms or regions of difference (RDs) (21). Most RDs are considered unique-event polymorphisms and have been used to define the six major lineages and several sublineages of M. tuberculosis (5). RD724 defines sublineage 724, a sublineage of the Euro-American lineage, and is characterized by a deletion (relative to H37Rv) of 1,129 bp (H37RV: 2265112 to 2266241) and by an IS6110 insertion at genomic address 2265111, in reverse orientation relative to the H37Rv sequence (14). M. tuberculosis isolates from this sublineage are common in Uganda (1). Here we report four distinct IS6110 insertion sites in the area where RD724 is located, a hot spot for IS6110 insertion not described previously.As part of the genetic analysis of M. tuberculosis isolates from a clinical trial (Tuberculosis Trials Consortium Study 28, comparing moxifloxacin versus isoniazid during the intensive phase of tuberculosis treatment) (3), we determined the presence of RDs to define the lineages and sublineages of M. tuberculosis (5). Among the 260 isolates screened for RD724, we found 5 with PCR products different in size from that expected for H37Rv and sublineage 724. These isolates are the focus of this study.Briefly, the PCR used to screen for RD724 was prepared with 1 μM forward primer RD724F (CCATGCGATTTGACTTCCGATTGA) and reverse primer RD724R (ATATACCGTGCCGCGACTTGCTCT), 0.4 mM deoxynucleoside triphosphates, 0.65 U of Taq polymerase, 1× buffer, 2.5 mM Mg²⁺, and 1× Qsol. The PCR cycle included 1 min at 96°C; 30 cycles of 40 s at 96°C, 40 s at 62°C, and 2 min at 72°C; and 1 cycle of 10 min at 72°C. The PCR product was run in a 1% agarose gel with a 1-kb ladder.Five isolates had a PCR product of 2,649 bp, larger than that expected for M. tuberculosis H37Rv (1,200 bp) and for isolates from sublineage 724 (1,521 bp) (Fig. ​(Fig.1).1). To determine the exact nature of the genetic polymorphism, we performed sequencing and blast analysis. The sequence reaction was performed using the primers described previously and internal primers RD724ipG (AATGGGAGCCGAGCGTGACTGC) and RD724ipN (AAATCAGCTTTGCCGACGAC) to bridge the polymorphism. Products were sequenced using ABI BigDye v3.1 dye terminator sequencing chemistry and the ABI PRISM 3730xl capillary DNA analyzer (Applied Biosystems) at the UCSF Genomic Core Facility (http://genomics.ucsf.edu/). The sequence data were analyzed using ClustalW (http://www.ebi.ac.uk/Tools/clustalw/index.html), and the blast analysis was performed using TubercuList (http://genolist.pasteur.fr/TubercuList/). We also performed IS6110 RFLP and spoligotyping on the five isolates according to previously described methodology (9, 22).Open in a separate windowFIG. 1.Gel electrophoresis of PCR-amplified gene fragments of the RD724 region. PCR products were run on a 1% agarose gel with ethidium bromide and visualized with UV light. Lanes are flanked by a 1-kb ladder. Lanes: WT, H37RV (wild type, 1,288 bp); PC, positive control with RD724 deleted (1,521 bp); NC, negative control; A1, isolate 369 (polymorphism A, 2,649 bp); A2, isolate 377 (polymorphism A, 2,649 bp); B, isolate 144 (polymorphism B, 2,649 bp); C, isolate 194 (polymorphism C, 2,649 bp); D, isolate 188 (polymorphism D, 2,666 bp).The sequences of all five PCR products did not reveal the deletion (relative to H37Rv) that characterizes RD724 (Fig. ​(Fig.2).2). In all cases, there was an insertion of an IS6110 element in a forward position relative to the H37Rv genome within the boundaries of RD724. In two isolates (no. 369 and 377), all 1,361 bp of the IS6110 element were inserted at genomic address 2265111 (polymorphism A), which is the same site where the IS6110 element in RD724 is inserted. This insertion site was reported previously in reference strain MTB14323 (15). This site corresponds to the intergenic region between Rv2017 (2263998 to 2265038) and Rv2018 (2265280 to 2265999). One isolate (no. 188) had all 1,361 bp of the IS6110 plus 17 bp that correspond to the last 17 bp of the IS6110 element inserted at 2265175 (polymorphism D), also corresponding to the intergenic region between Rv2017 and Rv2018. In one isolate (no. 144), all 1,361 bp of IS6110 were inserted at 2266167 (polymorphism B), and in another isolate (no. 194), all 1,361 bp of IS6110 were inserted at 2266216 (polymorphism C). These two insertion sites are located within Rv2019 (2265989 to 2266405), a gene that codes for a hypothetical protein. The IS6110 RFLP patterns (patterns not shown; number of bands included in Table ​Table1)1) and spoligotypes (Table ​(Table1)1) were different among the five isolates, indicating that none of the five isolates were epidemiologically related. Consequently, there are at least four independent IS6110 insertion sites in the area where RD724 is located.Open in a separate windowFIG. 2.Sites of IS6110 element insertion in the region of the large sequence polymorphism RD724. The schematic shows the sequence of H37RV in the 5′→3′ orientation. The white bar indicates the intergenic region between Rv2017 and Rv2018. The insertion of IS6110 (black triangle) and genomic deletion (under bracket) characterizing RD724 are shown above the bar. Dashed arrows represent primers 724F (Rv2265026 to Rv2265049) and 724R (Rv2266314 to Rv2266291). Four distinct IS6110 insertion sites are present (denoted by white triangles with the letters referring to the different polymorphisms). Strains with polymorphism A have an insertion at 2265111, those with polymorphism D have an insertion at 2265175, those with polymorphism B have an insertion at 2266167, and those with polymorphism C have an insertion at 2266216. The solid arrows below the triangles indicate the direction of the IS6110 element relative to H37Rv. The distance between IS6110 insertion sites in polymorphisms A and D is 64 bp, that in polymorphisms D and B is 992 bp, and that in polymorphisms B and C is 49 bp.

TABLE 1.

Sublineages, IS6110 band numbers,^a and spoligotypes of the isolates with different polymorphisms in the area of RD724

Evaluation of a simplified IS6110 PCR for the rapid diagnosis of Mycobacterium tuberculosis in an area with high tuberculosis incidence

Purpose

To assess the diagnostic yield of a simplified IS6110-PCR in an area with high tuberculosis incidence.

Methods

Pulmonary (218) and extrapulmonary (121) samples were collected from 236 patients including smearpositive leprosy patients. All samples were processed to detect acidfast bacilli by microscopy, culture on solid media and PCR. To remove PCR inhibitors, three washing steps of the decontaminated pellet were included before mycobacterial cell lysis by heat treatment. No detergents, enzymes, or chelating agents were used. From the 339 samples, 34 were selected basing on their large volume and were tested by the commercial kit GenoType Mycobacteria Direct (GTMD) (VER 4, Hain Lifescience, Germany) in addition to the tests cited above.

Results

The overall sensitivity and specificity of PCR were 93.8 and 98.6% for pulmonary samples, 63.6 and 100% for extrapulmonary samples, respectively. The assay detected MTC in 94.2% of smear positive samples with a positive predictive value of 100%. No inhibition was found among seven samples that were PCR negative but bacteriological confirmed as containing Mycobacterium tuberculosis. No false positive result occurred with samples from leprosy patients. The sensitivities for PCR and GTMD were 81.8 and 75%, respectively.

Conclusion

PCR could efficiently complement conventional bacteriological tools for the rapid diagnosis of tuberculosis but cannot replace them.     

Characterization of a Mycobacterium tuberculosis insertion sequence, IS6110, and its application in diagnosis

An insertion sequence-like element, IS6110, was isolated from a Mycobacterium tuberculosis cosmid library as a repetitive sequence. IS6110 shows similarities with elements of the IS3 family. This insertion sequence was found to be specific to mycobacteria belonging to the M. tuberculosis complex. For detection and identification of M. tuberculosis bacilli in uncultured specimens, oligonucleotides derived from the IS6110 sequence were used as primers and probes in polymerase chain reaction studies. The results obtained were consistent with results of classical identification procedures, bacteriological data, and clinical criteria.     

Chromosomal DNA fingerprint patterns produced with IS6110 as strain-specific markers for epidemiologic study of tuberculosis.

Mycobacterium tuberculosis isolates were studied by comparing chromosomal DNA fingerprint patterns produced by digestion of chromosomal DNA with BamHI, followed by agarose electrophoresis and hybridization with radiolabeled probes of insertion sequence IS6110. DNA fingerprints of 14 isolates from separate members of five households or closely associated individuals were compared. Marked differences were observed when unrelated isolates were compared. There were no or minimal differences in the restriction fragment patterns generated from isolates of any one household or associated group. Among related isolates, the only noticeable difference was an additional fragment of IS6110 in the fingerprint pattern of one isolate. Insertional activity was also suggested when restriction fragment patterns of H37Rv DNA isolated in 1987 and 1990 were compared. In a similar manner, M. tuberculosis reference strain Erdman was compared to a clinical isolate from an individual working with that strain. These isolates had identical DNA fingerprints which were distinct from all other isolates, verifying laboratory-acquired infection. Chromosomal DNA fingerprint patterns produced with IS6110 are excellent stain-specific markers for the epidemiologic study of tuberculosis.     

An IS6110-targeting fluorescent amplified fragment length polymorphism alternative to IS6110 restriction fragment length polymorphism analysis for Mycobacterium tuberculosis DNA fingerprinting

A rapid, simple and highly discriminatory DNA fingerprinting methodology which produces data that can be easily interpreted, compared and transported is the ultimate goal for studying the epidemiology of Mycobacterium tuberculosis. A novel TaqI fluorescent amplified fragment length polymorphism (fAFLP) approach to M. tuberculosis DNA fingerprinting that targeted the variable IS6110 marker was developed in this study. The new method was tested for specificity and reproducibility, and compared with the standard reference IS6110 restriction fragment length polymorphism (RFLP) method for a panel of 78 isolates. Clustering conflicts between the two methods were resolved using mycobacterial interspersed repetitive unit-variable number tandem repeat (MIRU-VNTR) data. Comparison with an in-silico digestion of strain H37Rv showed that fAFLP-detected fragments were highly specific in vitro. The reproducibility of repeated digestions of strain H37Rv was 100%. Clustering results obtained by fAFLP and RFLP were highly congruent, with fAFLP allocating 97% of RFLP-clustered isolates to the same eight clusters as RFLP. Two single-copy isolates that had been clustered by RFLP were not clustered by fAFLP, but the MIRU-VNTR patterns of these isolates were different, indicating that the RFLP data had falsely clustered these isolates. Analysis by fAFLP will allow rapid screening of isolates to confirm or refute epidemiological links, and thereby provide insights into the frequency, conservation and consequences of specific transposition events.     

Phospholipase region of Mycobacterium tuberculosis is a preferential locus for IS6110 transposition

Enzymes with phospholipase C activity in Mycobacterium tuberculosis have been recently described. The three genes encoding these proteins, plcA, plcB, and plcC, are located at position 2351 of the genomic map of M. tuberculosis H37Rv and are arranged in tandem. We have previously described the presence of variations in the restriction fragment length polymorphism patterns of the plcA and plcB genes in M. tuberculosis clinical isolates. In the present work we investigated the origin of this polymorphism by sequence analysis of the phospholipase-encoding regions of 11 polymorphic M. tuberculosis clinical isolates. To do so, a long-PCR assay was used to amplify a 5,131-bp fragment that contains the plcA and plcB genes and part of the plcC gene. In the M. tuberculosis strains studied the production of an amplicon approximately 1,400 bp larger than anticipated was observed. Sequence analysis of the PCR products indicated the presence of a foreign sequence that corresponded to an IS6110 element. We observed insertion elements in the plcA, plcB, and plcC genes. One site in plcB had the highest incidence of transposition (5 out of 11 strains). In two strains the insertion element was found in plcA in the same nucleotide position. In all the cases, IS6110 was transposed in the same direction. The high level of transposition in the phospholipase region can lead to the excision of fragments of genomic DNA by recombination of neighboring IS6110 elements, as demonstrated by finding the deletion, in two strains, of a 2,837-bp fragment that included plcA and most of plcB. This can explain the negative results obtained by some authors when detecting the mtp40 sequence (plcA) by PCR. Given the high polymorphism in this region, the use of the mtp40 sequence as a genetic marker for M. tuberculosis sensu stricto is very restricted.     

Restriction fragment length polymorphism analysis using IS6110 as an epidemiological marker in tuberculosis.

The mycobacterial insertion sequence IS6110 has been shown to be present in multiple copies in the chromosome of Mycobacterium tuberculosis. IS6110 restriction fragment length polymorphism analysis of strains isolated from patients who developed tuberculosis showed identical patterns over a 2- to 3-year period. In contrast, a high degree of polymorphism was observed between strains of the M. tuberculosis complex isolated from different patients. This study demonstrates that the presence of IS6110 does not induce in vivo major genomic rearrangements over a 2- to 3-year period and confirms its use as a valuable epidemiological marker in tuberculosis.     

Comparison of Variable Number Tandem Repeat and IS6110-Restriction Fragment Length Polymorphism Analyses for Discrimination of High- and Low-Copy-Number IS6110 Mycobacterium tuberculosis Isolates

The present study was designed to evaluate the use of variable number tandem repeat (VNTR) and IS6110-restriction fragment length polymorphism (RFLP) analyses in combination as a two-step strategy for discrimination (as measured by the Hunter-Gaston Discrimination Index [HGDI]) of both high- and low-copy-number IS6110 Mycobacterium tuberculosis isolates compared to IS6110-RFLP alone with an unselected collection of isolates. Individually, IS6110-RFLP fingerprinting produced six clusters that accounted for 69% of the low-copy-number IS6110 isolates (five clusters) and 5% of the high-copy-number IS6110 isolates (one cluster). A total of 39% of all the isolates were clustered (HGDI = 0.97). VNTR analysis generated a total of 35 different VNTR allele profile sets from 93 isolates (HGDI = 0.938). Combining IS6110-RFLP analysis with VNTR analysis reduced the overall percentage of clustered isolates to 29% (HGDI = 0.988) and discriminated a further 27% of low-copy-number isolates that would have been clustered by IS6110-RFLP alone. The use of VNTR analysis as an initial typing strategy facilitates further analysis by IS6110-RFLP, and more importantly, VNTR analysis subdivides some IS6110-RFLP-defined clusters containing low- and single-copy IS6110 isolates.     

Use of spoligotyping to study the evolution of the direct repeat locus by IS6110 transposition in Mycobacterium tuberculosis

Based on the variability of 43 spacers within the direct repeat (DR) locus of Mycobacterium tuberculosis complex organisms, spoligotyping is a rapid method that aids in the study of the epidemiology of tuberculosis. It was recently hypothesized that despite its presence in the DR locus, spacer 31 could not be amplified in M. tuberculosis clinical isolates belonging to spoligotype 50 due to the insertion of an extra copy of IS6110 between spacers 31 and 32 that could lead to an asymmetrical split of the primer targets (I. Filliol, C. Sola, and N. Rastogi, J. Clin. Microbiol. 38:1231--1234, 2000). In the present investigation, previous observations were extended to 25 clinical isolates of type 50 showing that the primer set IS6-DRb that selectively amplified the left and central DR regions was indeed able to demonstrate the presence of spacer 31. IS6110-restriction fragment length polymorphism (RFLP) and DR-RFLP showed that type 50 isolates were characterized by the presence of two copies of IS6110 associated with the DR locus and an additional double IS6110 band of 1.4 kb. The primer set IS3-IS6 was then used to selectively amplify a 750-bp inter-IS6110 fragment within the DR locus. The sequencing of the central DR region corroborated our previous findings and showed that the absence of spacer 31 among the type 50 isolates was due to the asymmetric insertion of an extra copy of IS6110 between spacers 31 and 32, leading to an unequal split of the DRa-DRb target into two portions, of 6 and 30 bp, respectively. These results show that the DR locus constitutes an ideal IS6110 preferential locus (ipl), permitting the insertion of two or more copies of IS6110, and provide new clues for epidemiological and phylogenetic interpretation of changes in IS6110-RFLP and spoligotyping profiles.     

Nonrandom Association of IS6110 and Mycobacterium tuberculosis: Implications for Molecular Epidemiological Studies

IS6110 restriction fragment length polymorphism typing is now established as the primary typing method for Mycobacterium tuberculosis. It has been assumed that the position of bands is random. Thus, the discrimination of the technique increases in proportion to the copy number. Two collections of M. tuberculosis were investigated to test this hypothesis. We identified 33 positions in isolates from a Tanzanian collection and 25 positions in isolates from a London, United Kingdom, collection where bands were significantly more likely to be present than would be expected by chance. These data suggest that band position is not random, and this possibility may have an impact on the interpretation of molecular epidemiological studies of M. tuberculosis.     

Specificity of IS6110-based DNA fingerprinting and diagnostic techniques for Mycobacterium tuberculosis complex

Restriction fragment length polymorphism and hybridization of DNA extracted from Mycobacterium tuberculosis, nontuberculous mycobacteria, and nonmycobacterial species with a probe derived from IS6110 confirmed that IS6110 was specific to M. tuberculosis complex. In addition, DNA amplification with IS6110-specific primers yielded a 181-bp fragment only in DNA from M. tuberculosis complex isolates.     

Transposition rates of Mycobacterium tuberculosis IS6110 restriction fragment length polymorphism patterns

To determine the rate at which IS6110 restriction fragment length polymorphism (RFLP) patterns in Mycobacterium tuberculosis change over time, we applied a smooth nonparametric survival model to several data sets, including data from previous publications on the rate of change. The results strongly suggest a simple parametric model, with an instantaneous change at time zero and essentially a zero rate of change thereafter. Our interpretation of the results is that at the time of collection of the first isolate, more than one strain is present. We speculate that the selection of mutant strains is most likely during rapid growth, revival of the dormant bacteria, and/or adaptation to a new host. The parameter most accurately describing changing RFLP patterns is the proportion of isolates with band changes, rather than the half-life or the rate of change.