Altered pattern of viral RNA synthesis in cells infected with standard and defective Sindbis virus

Serial passage of Sindbis virus on BHK cells results in the accumulation of defective interfering (DI) particles (Schlesinger et al., 1972). Cells infected with preparations of Sindbis passaged extensively on BHK cells (Sindbis H) produce reduced amounts of infectious virus and contain low levels of 42 S and 26 S RNA and 20 S RNase-resistant replicative form (RF). In Sindbis H-infected cells the major single-stranded RNA species sediments at 20 S and the RF at 12 S. The interfering component in Sindbis H is sensitive to ultraviolet light and indistinguishable from standard virions in haemagglutination inhibition tests.Sindbis M was prepared by passage of Sindbis H in suckling mouse brain. The presence of 42 S and 26 S single-stranded RNA and 20 S RNase-resistant RF in Sindbis M infected cells (up to passage 5) indicates that mouse brain-passaged Sindbis lacks demonstrable interfering components.     

Replication of standard and defective Ross River virus in BHK cells: Patterns of viral RNA and polypeptide synthesis

Summary Virus-specific macromolecule synthesis has been examined in BHK cells infected with Ross River virus. Unpassaged virus (R-0) and tenth-passage virus (R-10) have been compared. In infected cells R-0 generates i) 45S, 38S, 33S and 26S viral RNAs, ii) virus-specific precursor polypeptides of mol. wt. 127,000, 95,000 and 61,000 and iii) viral envelope proteins (mol. wts. 52,000 and 49,000) and nucleocapsid protein (mol. wt. 32,000). Thus in terms of virus-specific RNA and polypeptide synthesis, the replication of standard RRV is analogous to that of Semliki Forest virus and Sindbis virus.R-10 interferes with the replication of standard Ross River virus and generates large amounts of 19S and 24S defective RNA species; 45S and 26S RNA synthesis was not markedly affected. Defective RNAs are associated with RNAse-sensitive, 50S cytoplasmic particles which contain a variety of (mainly host) proteins but no nucleocapsid protein. No evidence for translation of defective RNAs was obtained.R-10 infection is also characterized by a relatively early shut down of host protein synthesis and by a reduction in virus-specific polypeptide synthesis and nucleocapsid formation. The data suggest that defective Ross River virus interferes primarily at the translational level.With 11 Figures     

Terminal sequences of Sindbis virus-specific nucleic acids: Identity in molecules synthesized in vertebrate and insect cells and characteristic properties of the replicative form RNA

The terminal sequences of the virus-specific nucleic acids synthesized in BHK vertebrate cells and in Aedes albopictus insect cells infected with the alphavirus Sindbis virus have been analyzed. The 26 S and 42 S plus-strand RNA molecules have the 5′-terminal sequences m⁷GpppAUAG and m⁷GpppAUAGGCGGCGUAGUACACAC, respectively. A 22 S replicative form (RF) RNA which contains an infectious 42 S plus-strand genome RNA molecule and a complementary 42 S negative-strand RNA accumulates in infected cells. The 5′-terminal sequence of the 42 S plus-strand RNA component of the RF is identical to that of the single-stranded plus-strand 42 S RNA molecule except for the absence of a 5′-terminal cap in the constituent of the RF RNA. The identification of a poly(U) sequence at the 5′-terminus of the 42 S minus strand RNA in our experiments is in accordance with earlier results obtained in other laboratories (Sawicki and Gomatos, 1976; Frey and Strauss, 1978). Analogous to our data concerning the structure of the RF RNA of the alphavirus Semliki Forest virus (Wengler et al., 1979) the 3′-terminus of the 42 S minus strand RNA component of the Sindbis virus-specific RF RNA is complementary to the 5′-terminus of the 42 S plus strand RNA molecule but in addition contains a 3′-terminal extra unpaired guanosine residue. The 3′-terminal sequence of the 42 S minus strand is strongly conserved between the two alphaviruses, Sindbis virus and Semliki Forest virus. The terminal sequences of the RF RNA synthesized in BHK and Aedes albopictus cells are identical. Analyses of the capped oligonucleotides derived from virus-specific single-stranded 42 S plus-strand RNA and from 26 S RNA strongly indicate that no base sequence differences exists between the corresponding molecules synthesized in either vertebrate or insect cells. Possible implications of these findings concerning the structure of alphavirus RF RNA and the synthesis of alphavirus-specific nucleic acids are discussed.     

Evidence for the synthesis of defective interfering particles by Aedes albopictus cells persistently infected with sindbis virus

The species of double- and single-stranded viral RNA in Aedes albopictus cells persistently infected with Sindbis virus have been analyzed. In addition to small amounts of 42-S and 26-S single-stranded and 23-S double-stranded viral RNA, persistently infected mosquito cells contain several new species of single-stranded RNA with molecular weights ranging from 0.65 x 108 to 1.0 x 108. New double-stranded RNA forms with sedimentation coefficients in the 12- to 15-S range are also detected. Similar double- and single-stranded RNA forms are synthesized in BHK cells after infection with virus released from persistently infected cells. Treatment of the virus from persistently infected cells with anti-Sindbis antiserum inhibits the synthesis of all the viral RNA species in BHK cells. These results suggest that DI particles of Sindbis virus may be synthesized and released from persistently infected A. albopictus cells.     

Protein analysis of defective interfering lymphocytic choriomeningitis virus and persistently infected cells.

Defective interfering (DI) lymphocytic choriomeningitis virus (LCMV) was purified from the culture fluids of BHK 21/13S and L-929 cells persistently infected with LCMV. DI LCMV sedimented in renografin-76 gradients to a density slightly less than standard (S) LCMV (1.13 vs 1.14 g/cm³). Polyacrylamide gel electrophoretic analysis of [³⁵S]methionine-labeled DI virus revealed a major 63,000-dalton polypeptide corresponding to the S virion nucleoprotein (NP), and two minor polypeptides corresponding to the S virion 54,000? and 35,000-dalton glycopeptides. No differences in polypeptide composition were detected between the DI and S virions. Exposure of cells to DI virus before S virus challenge inhibited the intracellular synthesis of the NP. Cells persistently infected with LCMV released no detectable S virus or temperature-sensitive mutants but did release DI LCMV. The production of DI LCMV by these cultures was 10? to 100-fold lower than S virus production during acute infections. These persistently infected cells contained intracytoplasmic NP, detectable by immunofluorescence, but its rate of synthesis was too low to be detected by the radiolabeling methods used. Although present in the cytoplasms, detectable viral antigens were absent from the cell membranes of many of these persistently infected cells. Thus, cells persistently infected with LCMV produce relatively low levels of DI virus which can inhibit viral protein synthesis. These factors may act to render infected cells resistant to immunosurveillance mechanisms during persistent infections in vivo.     

RNA synthesis in BHK 21 cells persistently infected with vesicular stomatitis virus and rabies virus.

Virus-induced RNA synthesis was studied in BHK 21 cells persistently infected with vesicular stomatitis virus (VSV) and rabies virus by labelling RNA synthesized in the presence of antinomycin D. During persistent infection the species of messenger RNA synthesized were similar in size and relative proportions to those seen during acute infection, but there were some minor differences. Full-sized B virion RNA was generally not detected during persistent infection, and new species (probably DI virion RNA) appeared.     

Characterization of rabies viruses recovered from persistently infected BHK cells.

Persistent rabies virus infection with a cyclic rising and falling pattern was easily initiated in BHK cells. In striking contrast with the same chronic infection established by T. J. Wiktor and H. F. Clark ((1972). Infect. Immun.6, 988–995), this virus and cell interaction was not mediated by interferon, and the infected cells were not resistant to a heterologous virus challenge. The persistently infected cells produced small-plaque viruses (SPV) and, after a number of subcultures, these SPV replaced entirely the wild large-plaque viruses (LPV). Due to the marked cytopathic effects (CPE) on BHK cells, SPV was less efficient than LPV for the establishment of viral persistence.A fraction containing defective interfering (DI) rabies virus particles was obtained by density gradient centrifugation of virus stocks from the persistently infected cells. The DI particles could be quantitatively assayed to the degree that they suppressed the CPE by the standard rabies virus. Cyclic production of DI particles in the persistent infection was demonstrated by this method. This evidence plus the fact that the homologous virus resisted superinfection indicate that the DI particles of rabies virus play a major role in the establishment and maintenance of a persistent state of infection in vitro.     

Mode of neutralization of lactate dehydrogenase-elevating virus by polyclonal and monoclonal antibodies

Summary Neutralization of the infectivity of [³H]uridine-labeled lactate dehydrogenase-elevating virus (LDV) by polyclonal mouse or rabbit antibodies to the envelope glycoprotein of LDV, VP-3, or by neutralizing monoclonal antibodies (mAb) that recognize a different epitope on VP-3 than the polyclonal antibodies correlated with an increase in the sedimentation rate of LDV from 230 S to 270 S. Incubation of LDV with normal mouse plasma or nonneutralizing mAbs to LDV VP-3 had no effect on its sedimentation rate. Similarly, incubation of a neutralization escape variant of LDV with the mAb used in its selection had no effect on its sedimentation rate, whereas neutralization of this variant by polyclonal mouse or rabbit anti-VP 3 antibodies increased the sedimentation rate. Neutralization of LDV infectivity was only observed at high antibody/virion ratios and often was followed by loss of the viral RNA. The results suggest that neutralization of LDV infectivity results from binding of multiple antibody molecules that recognize specific epitopes on the viral envelope glycoprotein and ultimately leads to disintegration of the virions.     

Comparison of Sindbis Virus-Induced Pathology in Mosquito and Vertebrate Cell Cultures

We have compared Sindbis virus-induced cytopathology in vertebrate and mosquito (Aedes albopictus) cell cultures. It has been shown that vertebrate cells undergo apoptosis when infected by Sindbis virus and this was confirmed here using hamster cells (BHK). The occurrence of cell death in Sindbis virus-infectedA. albopictuscells is a cell clone-specific phenomenon and, unlike in BHK cell cultures, mosquito cell death does not correlate with a large induction of apoptosis, as determined by assays testing for DNA fragmentation or reduced cellular DNA content. Cell cycle distribution changes were observed in Sindbis virus-infected BHK and C7-10 cell cultures, and the changes are distinct, both in the time of induction and the types of perturbations. In Sindbis virus-infected BHK cells, the major cell cycle profile change is the early accumulation of cells with sub-G1 DNA content and a corresponding reduction in the proportion of cells in G1 and G2/M. For Sindbis virus-infected C7-10 cells, the major perturbations are an increased proportion of cells showing G2/M or polyploid DNA content and a reduction in the proportion of G1 and S phase cells. These data suggest that the pathology induced in mosquito cell cultures by Sindbis virus infection may be distinct from the pathology which appears in vertebrate cell cultures.     

Proteins specified by group B togaviruses in mammalian cells during productive infections

Seven nonstructural and two of the three virion proteins specified by each of Kunjin, dengue type 2, St. Louis encephalitis, and Japanese encephalitis virus were labeled during replication in Vero and in PS cells which had been treated only with actinomycin. After host protein components were eliminated from electrophoretic profiles of infected cytoplasm using a double-label and subtraction method, all virusspecified proteins were readily identified. All profiles are similar but distinguishable from one another. The proteins are synthesized in the same but not in equimolar proportions for long periods. Molecular weight of the major core protein is 13,500 daltons, but the envelope protein ranges from 51,300 daltons (Kunjin) to 59,000 daltons (dengue). The major core protein of the Kunjin virion appeared to be either unstable in cytoplasm or was rapidly lost by incorporation into virions. No evidence was obtained for posttranslational cleavage; the information encoded in the RNA genome of 4.2 × 10⁶ daltons is sufficient to account for the total of about 370,000 daltons of virus-specified proteins.     

Defective interfering particles of Semliki Forest virus generated in BHK cells do not interfere with viral RNA synthesis in Aedes albopictus cells

Defective interfering (DI) particles of Semliki Forest virus (SFV) were generated by serial high multiplicity passage of plaque-purified virus on BHK cells. Defective interfering passages of SFV depressed the synthesis of 42 and 26 S viral RNA and induced the formation of two new single-stranded RNA forms (molecular weight, 1.2 × 10⁶ and 0.56 × 10⁶) in BHK and Vero cells but not in Aedes albopictus cells. These results suggest that the invertebrate cells restricted replication of the alphavirus DI particles.     

Studies on virus-specific nucleic acids synthesized in vertebrate and mosquito cells infected with flaviviruses

Virus-specific RNA molecules synthesized in BHK 21 vertebrate cells and in Aedes albopictus mosquito cells infected with the flaviviruses Uganda S (US) or West Nile (WN) have been characterized. A single-stranded (ss) RNA of plus polarity sedimenting at about 42 S was present in the virus particles. 42 S plus strand RNA was also the predominant species of virus-specific ss RNA accumulating in infected cells of both vertebrate and insect origin. No similarity was detected between the large oligonucleotides generated by ribonuclease T₁ from WN virus and US virus-specific 42 S plus strand RNA, respectively. No poly(A) sequences are present in either the US virus or the WN virus-specific 42 S plus strand RNA molecules synthesized in BHK cells. The 42 S plus strand RNA molecules present in WN virus-infected BHK cells do contain, however, a “cap” structure m⁷GpppAmpN₁, and in some of these molecules, a further methyl group is introduced, giving rise to the “cap” structure m⁷GpppAmpN₁mpN₂. These “caps” are also present on the 42 S RNA of WN virus particles synthesized in BHK cells. In addition to the 42 S RNA, virus-specific ss RNA of low molecular weight (LMW-RNA) was detected in all virus-cell systems analyzed. A single species of LMW-RNA of 5 × 10⁴ daltons apparent molecular weight was present in US virus-infected vertebrate and insect cells. Two LMW-RNA species of about 6.5 × 10⁴ daltons (WM LMW-1 RNA) and 4.2 × 10⁴ daltons (WN LMW-2 RNA) molecular weight, respectively, were isolated from WN virus-infected BHK cells. Only the larger of these was detected in WN virus-infected insect cells. The LMW-1 RNA present in WN virus-infected BHK cells has been characterized in somewhat more detail. It contains virus-specific RNA sequences of plus strand polarity, is not “capped”, and does not contain a poly(A) sequence. None of the single-stranded, virus-specific RNA molecules synthesized in either vertebrate or mosquito cells bound to oligo(dT)-cellulose. Only a single species of virus-specific RNA containing minus strand sequences was detected in WN virus-infected BHK cells. This RNA was of genome size and was present as part of a double-stranded RNA complex containing 42 S RNA of both plus and minus polarity.     

Studies on the synthesis of viral RNA-polymerase-template complexes in BHK 21 cells infected with Semliki Forest virus.

Two main types of virus-specific RNA sedimenting at about 42 and 26 S, respectively, on sucrose density gradients are synthesized in animal cells infected with Semliki Forest virus (SFV). Two and one-quarter hours after infection of BHK 21 cells with SFV only about 10% of the total amount of virus-specific RNA that accumulates during the 8-hr growth cycle of the virus have been synthesized. If at this time an inhibitor of protein synthesis, cycloheximide, is added to infected cells, both of these RNA species are synthesized during the viral growth cycle with the same time course and in amounts similar to those in untreated cultures. This result suggests that the RNA polymerase-template complexes present at 2.25 hr post infection (p.i.) are stable and synthesize all virus-specific 42 and 26 S RNA accumulating during the viral growth cycle. These polymerase-template complexes are synthesized between 45 min and 2.25 hr p.i.During multiplication of SFV in BHK 21 cells the amount of radioactivity incorporated from radioactively labeled amino acids into protein during a series of labeling intervals decreases, and the ratio of synthesis of virus-specific proteins to cellular proteins increases. Both of these effects are not expressed to a significant extent at 2.25 hr post infection (p.i.). Sodium dodecyl sulfate-polyacrylamide-gel electrophoretic (SDS-PAGE) analysis of the polypeptides synthesized in infected cultures shortly after removal of cycloheximide, which had been present from 2.25 – 6 hr p.i. shows that cycloheximide does not block the development of these changes in cellular protein synthesis. Some implications of these findings concerning the synthesis of virus-specific RNA and the interference of virus multiplication with cellular protein synthesis are discussed.     

Regulation of the synthesis of Sindbis virus-specified RNA: role of the virion core protein

Cells infected with seven different RNA+ mutants of Sindbis virus were found to accumulate a virus-specified polypeptide of mol. wt. 144000 (p144) during incubation at the non-permissive temperature, while at the same time synthesis of the virus structural proteins was drastically reduced. Mapping of the tryptic peptides of p144 showed that it contained the amino acid sequences of all the virus structural proteins. At the non-permissive temperature cells infected with the same seven mutants (out of 28 examined) also showed increased synthesis of 26S RNA, the mRNA for the virus structural proteins, relative to 42S RNA, and the virus genome, compared with infections by wild-type virus. We propose that both these phenotypic effects are the results of a single mutational step and that the primary defect in the processing of the virus structural protein precursor induces the relatively increased rate of synthesis of structural protein mRNA. Temperature-shift experiments with mutant-infected cells showed that p144 itself is not the agent of this effect. The failure of exposure to zinc ions to alter the RNA ratio in wild-type virus-infected cells suggested that the virus envelope proteins are not involved either, since their synthesis is preferentially inhibited under these circumstances. It is possible that it is the failure to synthesize the proper quantity of core protein in the mutant-infected cells which causes the shift of RNA synthesis in favour of structural protein mRNA.     

Sindbis virus variants from a persistently infected mosquito cell culture contain an altered E2 glycoprotein

Small plaque temperature-sensitive (SPTS) variants of Sindbis virus were isolated from persistently infected Aedes albopictus cells 73 days after infection with wild-type virus. The viral RNA and protein species synthesized in chick embryo fibroblast (CEF) cells infected by one variant, clone 73-2, were compared with their wild-type virus counterparts. T1 RNase fingerprints of ³²P-labeled intracellular 42 S and 26 S viral RNA species revealed that clone 73-2 virus RNA differed from wild-type virus RNA in four oligonucleotide spots. Three of these were located in the region of the genome coding for structural proteins. Analysis of the virus structural proteins by polyacrylamide gel electrophoresis indicated that clone 73-2 virus glycoprotein E2 had a higher electrophoretic mobility than wild-type virus E2. Analysis of the proteins synthesized in infected cells in the presence and absence of tunicamycin revealed that both the glycosylated and unglycosylated forms of clone 73-2 PE2 migrated slightly faster than their wild-type virus counterparts.     

Replication of lactic dehydrogenase virus and Sindbis virus in mouse peritoneal macrophages. Induction of interferon and phenotypic mixing.

Mouse peritoneal macrophages stimulated by thioglycollate can proliferate in culture for over 2 wk. Sindbis virus replicates in these cells, but not in the initial exudate culture. Lactic dehydrogenase virus (LDV) also produces higher yields in the exponentially growing cells. Proliferating macrophages infected with LDV induce a factor that inhibits the replication of Sindbis virus. The factor was identified as interferon by its species specificity and its acid stability. Macrophages that have been in culture for only 24 hr do not produce interferon. Replication of Sindbis virus in LDV-infected macrophages leads to phenotypic mixing between the two virions. We have detected both pure pseudotypes—virions containing the RNA of Sindbis virus and the envelope of LDV—and particles containing the envelope proteins of both virions. Our results demonstrate that the restricted host range of LDV is not due to the inability of the virus to adsorb to cells other than macrophages.     

Properties of Sindbis virus vectors produced with a chimeric split helper system

We have evaluated a chimeric, two-component Sindbis virus packaging system. As expected, use of this combination of two modified helper RNA species prevented formation of infection competent Sindbis viruses as analyzed by serial passaging. We observed, however, that vectors produced using this method were able to spread in BHK cell cultures and formed clusters of transgene positive cells that did not display cytopathic effects for up to 3 days post-transduction. Formation of spreading Sindbis virus vectors required only one of the helper components--the chimera with a deleted Ross River virus capsid and the Sindbis virus envelope glycoproteins. Spreading was also demonstrated in two rat glioma cell lines, 9L and BT4C, showing that this phenomenon was not limited to BHK cells. Our results warrant further characterization of split helper Sindbis virus vectors and imply their utility in gene therapy approaches where spreading of transgene expression and consequently high gene transfer rate could be beneficial.     

Studies on tumorigenicity of cells persistently infected with vesicular stomatitis virus in nude mice

Previous work has demonstrated that persistent infection of cultured cells (normally tumorigenic in the nude mouse) by any of a number of enveloped RNA viruses results in the loss of their ability to form tumors in nude mice. From the BHK 21/VSV persistently infected cell line which did not form tumors in these nude mice, we selected in vivo a subline which is tumorigenic even though it is still persistently infected. We report here a preliminary characterization of this subline. These virus-infected cells were consistently tumorigenic for more than six sequential passages in nude mice. They shed large amounts of virus and DI particles into the bloodstream and tissues of the mice; however, we found no evidence of the virus establishing a persistent infection in the mouse tissues. We demonstrated that virus isolated from this tumorigenic cell line was able to establish new persistently infected cell lines which were also tumorigenic, indicating that this is a characteristic of the virus. T₁ oligonucleotide mapping of the virion RNA recovered from this tumorigenic carrier subline demonstrates that the viral genome is undergoing continual mutation in vivo. This is similar to mutational changes occurring in vitro in the parental persistently infected cells. Very recently, the BHK 21 cell line persistently infected with VSV for over 5 years has spontaneously (with no in vivo selection) acquired the ability to form tumors in nude mice. In contrast to the other tumorigenic subline, this carrier line produces almost no mature virus or DI particles at present, and its tumorigenicity appears to be associated with very low virus expression in infected cells. Apparently, viruses can escape the natural killer (NK) cell response by a variety of means.     

Viral genome synthesis in BHK 21 cells persistently infected with Sendai virus

We have carried out daily analysis of the viral RNA species replicated by nucleocapsids present in the cytoplasm of two different BHK 21 cell lines persistently infected with Sendai virus. At each day of analysis (both before and after crises of cytopathology, and during long periods of stable growth) DI particle size RNA was the major species of viral RNA replicated within these nucleocapsids. The molar ratio of DI RNA to standard virus (50 S) RNA species within intracellular nucleocapsids was always extremely high (from 10/1 to 340/1). Thus, there is no evidence for cyclic variations in relative predominance of standard virus and DI nucleocapsids in populations of these persistently infected cells, although “cycling” could occur at the individual cell level at infrequent intervals. Furthermore, challenge of persistently infected cultures with standard Sendai virus or incubation at 33° also failed to significantly decrease the ratio of DI nucleocapsids to standard virus nucleocapsids. It was also found that multiple DI RNA species are present (most are not resolvable by sucrose gradient analysis), and that these evolve with time—some arising and increasing with time, while others are outcompeted. No selective advantage for DI RNA of any particular size was observed. Finally, by measuring the total amount of nucleocapsids present in these persistently infected cells (as estimated by level of NP protein in purified nucleocapsids), and the degree of synthesis of viral nucleocapsid (as determined by [³H]uridine incorporation in the presence of actinomycin D), we found that the rate of viral genome replication was 30- to 40-fold lower in the persistently infected cells than it was in St acutely infected cells. These findings may indicate that the accumulated nucleocapsids in persistently infected cells are built up over a period of many weeks of slow synthesis, although turnover times for NP protein and RNA of nucleocapsids have not yet been determined in persistently infected cells.