High-Resolution Melt Curve Analysis for Identification of Single Nucleotide Mutations in the Quinolone Resistance Gene aac(6′)-Ib-cr

We have developed a simple PCR-based high-resolution melt curve analysis for identification of the quinolone resistance gene aac(6′)-Ib-cr through regions encompassing the two defining single nucleotide mutations. Dissociation curves showed 100% concordance with DNA sequencing, including the identification of a strain where aac(6′)-Ib and aac(6′)-Ib-cr coexist.The cr variant of aac(6′)-Ib encodes an aminoglycoside acetyltransferase that confers reduced susceptibility to ciprofloxacin and norfloxacin by N acetylation of their piperazinyl amines (8). aac(6′)-Ib-cr belongs to the group of plasmid-mediated quinolone resistance genes that determine small increases in the MICs that are sufficient to facilitate the selection of higher-level-resistance mutants (10). However, this low-level quinolone resistance is below the CLSI breakpoint for nonsusceptibility and is not detected in the clinical laboratory. Development of efficient techniques for detection of clinical isolates carrying aac(6′)-Ib-cr may improve optimization of antibiotic treatment. The resistance phenotype of AAC(6′)-Ib-cr is dependent on the effects of the individual mutations. Asp181Tyr (coded by G541T) produces a partial-resistance phenotype and Trp104Arg (coded by either T310C or T310A) no detectable resistance, but together, the two mutations confer the full resistance phenotype (the nucleotide positions correspond to GenBank accession number {"type":"entrez-nucleotide","attrs":{"text":"AF479774","term_id":"19698424","term_text":"AF479774"}}AF479774; see also the cr variant under GenBank accession number {"type":"entrez-nucleotide","attrs":{"text":"AY259086","term_id":"30349182","term_text":"AY259086"}}AY259086) (8). We previously showed that the gap-ligase chain reaction (LCR) is an inexpensive technique suited to large-scale surveys, albeit time-consuming (13).Improved real-time PCR machines and software analysis packages in recent years have enhanced the resolution of melting temperature (T_m) differences between amplicons from 2°C to 0.01°C in modern instruments (4, 7). Such resolution is now sufficient for identification of transitions or transversions that involve A ↔ C or G ↔ T and can be applied in high-resolution melting curve analysis (HRMA) to identify a single nucleotide change inside a full-length amplicon (12). Melt analysis and its more sophisticated high-resolution variant are being increasingly applied to identify quinolone resistance mutations in type II topoisomerases of Haemophilus influenzae (5) and Neisseria gonorrhoeae (11), to genotype Mycoplasma pneumoniae isolates (9), or to identify multidrug-resistant Mycobacterium tuberculosis (6). We developed and validated a real-time PCR-based HRMA using SYBR green I to rapidly detect aac(6′)-Ib-cr and distinguish it from aac(6′)-Ib.A homology search in GenBank identified 181 sequences described as aac(6′)-Ib, of which 22 corresponded to the aac(6′)-Ib-cr variant. Alignment of all sequences was used to design two pairs of primers (Geneious Pro 4) (2). The pair comprising aac6-5′278 (GTCGTACGTTGCTCTTGGAA) and aac6-5′352 (GGTCTATTCCGCGTACTCCT) and the pair comprising aac6-3′508 (GGGTTTGAGAGGCAAG GTA) and aac6-3′582 (GAATGCCTGGCGTGTTTG) amplified 73- and 74-bp products, designated the 5′ region and the 3′ region, respectively, that corresponded to nucleotides 278 to 352 and 508 to 582, respectively, in aac(6′)-Ib (GenBank accession number {"type":"entrez-nucleotide","attrs":{"text":"AF479774","term_id":"19698424","term_text":"AF479774"}}AF479774).In developing the HRMA method, we used four different alleles of aac(6′)-Ib that we had previously generated by site-directed mutagenesis (8): aac0, encoding wild-type aac(6′)-Ib; aac1, encoding aac(6′)-Ib-cr; and aac2 and aac3, encoding aac(6′)-Ib with single mutations T310C and G541T, respectively. The assay was validated on nine aac(6′)-ib-cr-positive and 10 wild-type strains from a collection of clinical isolates already screened for aac(6′)-Ib-cr by gap-LCR and verified by sequencing (13).Plasmid DNA from control strains was extracted using a QIAamp DNA minikit (Qiagen, Valencia, CA) in accordance with the manufacturer''s instructions. Colonies were transferred to Tris-HCl (pH 7.4) in a 2-ml screw-cap tube and heated for 2 min at 98°C to prepare DNA templates from tested strains.Real-time PCR and HRMA were performed using a Rotor-Gene 6000 apparatus (Corbett Life Science, Australia) in a total volume of 20 μl; the run consisted of 30 cycles at 93°C for 10 s, followed by 58°C for 10 s and 72°C for 6 s. The high-resolution-melt (HRM) conditions were 2 s at 95°C followed by 90 s at 55°C premelt, with an HRM ramp from 76°C to 86°C, rising by 0.04°C each step and holding for 2 s on each step. Gain optimization before the melt on all tubes was selected. SYBR green I (DyNAmo Flash SYBR green quantitative PCR [qPCR] kit; Finnzymes) was used with an excitation wavelength at 470 nm and detection at 510 nm. For normalization, the temperature ranges were 75.34°C to 77.51°C for the leading range and 82.39°C to 84.30°C for the trailing range. Calculations were done using the Rotor-Gene software program (version 1.7). A confidence value is provided as an integrity check of autocalled results. Serial 10-fold dilutions of extracted DNA from the control strains were amplified and subjected to HRMA. The distinctive typing that resulted from the type-specific melt profiles of the 5′ region (Fig. ​(Fig.11 A) and the 3′ region (Fig. ​(Fig.1B)1B) showed that all amplicons were reliably sorted into one of the two distinct groups within each region.Open in a separate windowFIG. 1.Dissociation curves. Normalized and temperature-shifted difference plots for mutant discrimination by HRMA. (A) Normalized melt curve plot of the 5′ region showing T → C transition and (as shown in the nested graph) the normalized temperature minus the temperature shift for the same amplicon (T). (B) Normalized melt curve plot of the 3′ region, showing G → T transversion and (as shown in the nested graph) the normalized temperature minus the temperature shift for the same amplicon (G). Corresponding nucleotides (C, G, and T) are depicted next to each curve. The nucleotide present in aac(6′)-Ib was used to normalize each temperature shift graph. Dotted lines correspond to a heterozygote.The estimated error rates for genotyping homozygotes as a function of their T_m varied from instrument to instrument, and this rate was found to be less than 0.01 at 0.5°C for an amplicon of 110 bp with the use of the Rotor-Gene 3000 instrument (4). The intra-assay variation was calculated for two replicas of four 10-fold dilutions of each mutant. The standard deviations (SD) of the T_m varied from 0.01 (with a T_m of 79.20°C for nucleotide T in the 5′ region and a 73-bp amplicon) to 0.055 (for nucleotide T in the 3′ region with a T_m of 79.26°C and an amplicon of 74 bp). The differences in T_m (ΔT_m) between amplicons for the 5′ and 3′ regions were 0.62°C and 0.71°C, respectively, with a confidence level above 97% in all cases.As expected, no PCR products were obtained from dozens of clinical strains lacking aac(6′)-Ib and its variant. We then assayed 43 carbapenemase-producing Enterobacteriaceae with an unknown aac(6′)-Ib genotype isolated from wounds, sputa, and urine samples. One and 41 isolates were positive for aac(6′)-Ib-cr and aac(6′)-Ib, respectively; the HRMA results for these amplicons were sorted in the expected group, with confidence averages of 97.9% for the 5′ region (SD = 2.3) and 97.1% for the 3′ region (SD = 2.1). For one strain, a dissociation curve was interpreted as having variations (less than 85% confidence) in both the 5′ and the 3′ regions (Fig. ​(Fig.1).1). The distinct T_m plot of this amplicon is visible on the normalized graphics (Fig. ​(Fig.1,1, nested graphics). Sequencing demonstrated double peaks corresponding to the nucleotides cytosine and thymine at position 310 and guanine and thymine at position 541 in aac(6′)-Ib-cr.PCR products were obtained for every strain used for validation, thus supporting the utility of the boiling extraction method as a reliable, fast, and inexpensive method for obtaining whole-cell DNA as a template for this PCR.HRMA may detect other mutations that are not the target of the screening within the amplified region. In addition, because the melting temperature is the same, the HRMA might not have detected a T310A mutation. Recently, a report on the detection of aac(6′)-Ib-cr through its T310C or T310A mutations by the use of an asymmetric concentration of primers to promote amplification of the DNA strand complementary to an unlabeled and 3′ phosphorylated probe for HRMA was published (1). An evolutionary step for aac(6′)-Ib with a single mutation in either position 310 or position 541 (not investigated in that study) is plausible (1, 3), and its identification would be an important contribution to the understanding of the evolution of aac(6′)-Ib-cr and the tracking of its epidemiology. By analyzing the two aac(6′)-Ib-cr-characterizing regions, we ensured the accuracy of detection of the cr variant, even indicating whether this variant had been determined by a mutation at position 541. We have developed a simple and rapid real-time PCR-based HRMA that is able to detect aac(6′)-Ib-cr and discriminate between the two aac(6′)-Ib single nucleotide mutations required for the ciprofloxacin resistance phenotype. This approach provides an improvement over laborious procedures such as gap-LCR or expensive sequencing methods. Further research is needed in applying rapid diagnostic procedures for the detection of additional plasmid-mediated quinolone resistance genes.     

Molecular and Epidemiological Characterization of IMP-Type Metallo-β-Lactamase-Producing Enterobacter cloacae in a Large Tertiary Care Hospital in Japan

IMP-type metallo-β-lactamase enzymes have been reported in different geographical areas and in various Gram-negative bacteria. However, the risk factors and epidemiology pertaining to IMP-type metallo-β-lactamase-producing Enterobacter cloacae (IMP-producing E. cloacae) have not been systematically evaluated. We conducted a retrospective, matched case-control study of patients from whom IMP-producing E. cloacae isolates were obtained, in addition to performing thorough molecular analyses of the clinically obtained IMP-producing E. cloacae isolates. Unique cases with IMP-producing E. cloacae isolation were included. Patients with IMP-producing E. cloacae were matched to uninfected controls at a ratio of 1 to 3. Fifteen IMP-producing E. cloacae cases were identified, with five of the isolates being obtained from blood, and they were matched to 45 uninfected controls. All (100%) patients from whom IMP-producing E. cloacae isolates were obtained had indwelling devices at the time of isolation, compared with one (2.2%) uninfected control. Independent predictors for isolation of IMP-producing E. cloacae were identified as cephalosporin exposure and invasive procedures within 3 months. Although in-hospital mortality rates were similar between cases and controls (14.3% versus 13.3%), the in-hospital mortality of patients with IMP-producing E. cloacae-caused bacteremia was significantly higher (40%) than the rate in controls. IMP-producing E. cloacae isolates were frequently positive for other resistance determinants. The MICs of meropenem and imipenem were not elevated; 10 (67%) and 12 (80%) of the 15 IMP-producing E. cloacae isolates had a MIC of ≤1 μg/ml. A phylogenetic tree showed a close relationship among the IMP-producing E. cloacae samples. Indwelling devices, exposure to cephalosporin, and a history of invasive procedures were associated with isolation of IMP-producing E. cloacae. Screening for carbapenemase production is important in order to apply appropriate clinical management and infection control measures.     

Successful Gene Therapy in the RPGRIP1-deficient Dog: a Large Model of Cone–Rod Dystrophy

For the development of new therapies, proof-of-concept studies in large animal models that share clinical features with their human counterparts represent a pivotal step. For inherited retinal dystrophies primarily involving photoreceptor cells, the efficacy of gene therapy has been demonstrated in canine models of stationary cone dystrophies and progressive rod–cone dystrophies but not in large models of progressive cone–rod dystrophies, another important cause of blindness. To address the last issue, we evaluated gene therapy in the retinitis pigmentosa GTPase regulator interacting protein 1 (RPGRIP1)-deficient dog, a model exhibiting a severe cone–rod dystrophy similar to that seen in humans. Subretinal injection of AAV5 (n = 5) or AAV8 (n = 2) encoding the canine Rpgrip1 improved photoreceptor survival in transduced areas of treated retinas. Cone function was significantly and stably rescued in all treated eyes (18–72% of those recorded in normal eyes) up to 24 months postinjection. Rod function was also preserved (22–29% of baseline function) in four of the five treated dogs up to 24 months postinjection. No detectable rod function remained in untreated contralateral eyes. More importantly, treatment preserved bright- and dim-light vision. Efficacy of gene therapy in this large animal model of cone–rod dystrophy provides great promise for human treatment.     

Clinical Epidemiology and Molecular Analysis of Extended-Spectrum-β-Lactamase-Producing Escherichia coli in Nepal: Characteristics of Sequence Types 131 and 648

Recently, CTX-M-type extended-spectrum-β-lactamase (ESBL)-producing Escherichia coli strains have emerged worldwide. In particular, E. coli with O antigen type 25 (O25) and sequence type 131 (ST131), which is often associated with the CTX-M-15 ESBL, has been increasingly reported globally; however, epidemiology reports on ESBL-producing E. coli in Asia are limited. Patients with clinical isolates of ESBL-producing E. coli in the Tribhuvan University teaching hospital in Kathmandu, Nepal, were included in this study. Whole-genome sequencing of the isolates was conducted to analyze multilocus sequence types, phylotypes, virulence genotypes, O25b-ST131 clones, and distribution of acquired drug resistance genes. During the study period, 105 patients with ESBL-producing E. coli isolation were identified, and the majority (90%) of these isolates were CTX-M-15 positive. The most dominant ST was ST131 (n = 54; 51.4%), followed by ST648 (n = 15; 14.3%). All ST131 isolates were identified as O25b-ST131 clones, subclone H30-Rx. Three ST groups (ST131, ST648, and non-ST131/648) were compared in further analyses. ST648 isolates had a proportionally higher resistance to non-β-lactam antibiotics and featured drug-resistant genes more frequently than ST131 or non-ST131/648 isolates. ST131 possessed the most virulence genes, followed by ST648. The clinical characteristics were similar among groups. More than 38% of ESBL-producing E. coli isolates were from the outpatient clinic, and pregnant patients comprised 24% of ESBL-producing E. coli cases. We revealed that the high resistance of ESBL-producing E. coli to multiple classes of antibiotics in Nepal is driven mainly by CTX-M-producing ST131 and ST648. Their immense prevalence in the communities is a matter of great concern.     

Analysis of the heterogeneity of “faking” and “simulating” performance in the hypnotic setting

A balanced design was adopted where an attempt was made to replicate Overley and Levitt's (1968) finding of “faking heterogeneity” by applying their essential procedures, while also attempting to show that under demonstrably different conditions heterogeneity no longer exists. Results for 4 independent sets of 10 “faking” Ss given Overley and Levitt's set of role-playing instructions were compared with data from real and “simulating” Ss tested in application of Orne's (1959) real-simulating model of hypnosis. Heterogeneity of role-playing performance in the hypnotic test-setting was replicated for “faking” but not for “simulating” Ss, and both delay-in-instruction and the susceptibility level of the faking S were related to the effect. Evidence indicated that the earlier finding of heterogeneity of faking performance was a real one, but that Overley and Levitt's faking procedures were not proper to the task of simulation that they were questioning.     

Metabolism in Human Cells of the d and l Enantiomers of the Carbocyclic Analog of 2′-Deoxyguanosine: Substrate Activity with Deoxycytidine Kinase,Mitochondrial Deoxyguanosine Kinase,and 5′-Nucleotidase

The carbocyclic analog of 2′-deoxyguanosine (CdG) has broad-spectrum antiviral activity. Because of recent observations with other nucleoside analogs that biological activity may be associated the l enantiomer rather than, as expected, with the d enantiomer, we have studied the metabolism of both enantiomers of CdG to identify the enzymes responsible for the phosphorylation of CdG in noninfected and virally infected human and duck cells. We have examined the enantiomers as substrates for each of the cellular enzymes known to catalyze phosphorylation of deoxyguanosine. Both enantiomers of CdG were substrates for deoxycytidine kinase (EC 2.7.1.74) from MOLT-4 cells, 5′-nucleotidase (EC 3.1.3.5) from HEp-2 cells, and mitochondrial deoxyguanosine kinase (EC 2.7.1.113) from human platelets and CEM cells. For both deoxycytidine kinase and mitochondrial deoxyguanosine kinase, the l enantiomer was the better substrate. Even though the d enantiomer was the preferred substrate with 5′-nucleotidase, the rate of phosphorylation of the l enantiomer was substantial. The phosphorylation of d-CdG in MRC-5 cells was greatly stimulated by infection with human cytomegalovirus. The fact that the phosphorylation of d-CdG was stimulated by mycophenolic acid and was not affected by deoxycytidine suggested that 5′-nucleotidase was the enzyme primarily responsible for its metabolism in virally infected cells. d-CdG was extensively phosphorylated in duck hepatocytes, and its phosphorylation was not affected by infection with duck hepatitis B virus. These results are of importance in understanding the mode of action of d-CdG and related analogs and in the design of new biologically active analogs.d-CdG is an analog of CdG that has broad-spectrum antiviral activity (27–29). Until recently, the biological activity of a nucleoside analog was assumed to be due only to the “natural” β-d form. However, there are now numerous observations of antiviral activity associated with nucleosides in l configurations (for reviews, see references 10 and 26) and one report of antitumor activity associated with a β-l enantiomer (11). Even though l-CdG is much less active against HSV (4) and HCMV (unpublished results), it is essential that the metabolism of both enantiomers be examined to thoroughly understand the mechanism of action of a nucleoside analog. We have reported earlier that both enantiomers of CdG are extensively phosphorylated in cells infected with HSV-1 and that the enantiomers had equal activities as substrates for the virus-encoded kinase (4, 5). It was also observed that d-CdG was converted to its triphosphate (but to a much lesser extent) in noninfected cells and that more than one enzyme appeared to be involved in the initial phosphorylation. Since cellular enzymes presumably are responsible for the activation of CdG in cells infected with HBV (which is not known to code for a kinase) and may also be important for the activation of CdG in cells infected with HCMV (which induces cellular kinases [6, 8, 21, 23, 32, 44], in addition to encoding a ganciclovir-phosphorylating enzyme [22, 35]), we have evaluated the enantiomers of CdG as substrates for the three cellular enzymes known to catalyze phosphorylation of deoxyguanosine (2): dCyd kinase, mitochondrial dGuo kinase, and 5′-nucleotidase. We also report here observations on the metabolism of d-CdG in cells infected with HCMV and in duck hepatocytes infected with DHBV.(Some of these results have been presented elsewhere in preliminary form [1].)     

The Effect of Primer-Template Mismatches on the Detection and Quantification of Nucleic Acids Using the 5′ Nuclease Assay

Real-time polymerase chain reaction (PCR) is the current method of choice for detection and quantification of nucleic acids, especially for molecular diagnostics. Complementarity between primers and template is often crucial for PCR applications, as mismatches can severely reduce priming efficiency. However, little quantitative data on the effect of these mismatches is available. We quantitatively investigated the effects of primer-template mismatches within the 3′-end primer region on real-time PCR using the 5′-nuclease assay. Our results show that single mismatches instigate a broad variety of effects, ranging from minor (<1.5 cycle threshold, eg, A–C, C–A, T–G, G–T) to severe impact (>7.0 cycle threshold, eg, A–A, G–A, A–G, C–C) on PCR amplification. A clear relationship between specific mismatch types, position, and impact was found, which remained consistent for DNA versus RNA amplifications and Taq/Moloney murine leukemia virus versus rTth based amplifications. The overall size of the impact among the various master mixes used differed substantially (up to sevenfold), and for certain master mixes a reverse or forward primer-specific impact was observed, emphasizing the importance of the experimental conditions used. Taken together these data suggest that mismatch impact follows a consistent pattern and enabled us to formulate several guidelines for predicting primer-template mismatch behavior when using specific 5-nuclease assay master mixes. Our study provides novel insight into mismatch behavior and should allow for more optimized development of real-time PCR assays involving primer-template mismatches.During the past decade, real-time polymerase chain reaction (PCR) has established itself as an essential technique for reliable detection and quantification of nucleic acids.^1,2,3 The result is a widespread application of real-time PCR assays in both research^1,2,3,4 and diagnostic^4,5,6 laboratories. Vital to the specificity, sensitivity, and efficiency of real-time PCR are the primers. The most important primer characteristics contributing to a successful amplification are primer-template association and dissociation kinetics, possible secondary structures, and primer-template complementarity (Watson-Crick base-pairing).^7,8 Full complementarity between primer and template sequences is generally considered crucial for the specific amplification of a nucleic acid sequence, but can be difficult to achieve, in particular for applications depending on highly heterogenic nucleic acid input for amplification (eg, diagnostic assays for influenza virus and human immunodeficiency virus). Conserved regions are often too small to accommodate a typical real-time PCR assay (50 to 150 bp), exhibit inferior G-C contents or are prone to the formation of secondary structures. Primer-template mismatches can therefore be unavoidable.Unfortunately, mismatches between primers and template are known to affect both the stability of the primer-template duplex and the efficiency with which the polymerase extends the primer,^{7,8,9,10,11,12,13} potentially leading to biased results or even PCR failure.^14,15 Even apparently small effects on nucleic acid quantification (0.5 to 1.0 log underestimation of initial copy number) can have serious consequences, as illustrated by studies on the relation between viral load and disease prognosis in HIV-1.¹⁶The detrimental effects of primer-template mismatches can however also prove beneficial. They provide a discriminative force that can be used for PCR assays opting to distinguish between different nucleic acids (eg, single nucleotide polymorphism detection, allele-specific PCR), which have become important tools for modern molecular diagnostics.⁴Every mismatch, irrespective of its location within the primer sequence, will result in a decreased thermal stability of the primer-template duplex, thus potentially affecting PCR specificity. However, mismatches located in the 3′ end region (defined as the last 5 nucleotides of the 3′ end region) of a primer have significantly larger effects on priming efficiency than more 5′ located mismatches,^{9,11,13,14,15} since 3′ end mismatches can disrupt the nearby polymerase active site.^17,18Strategies to alter mismatch impact, eg, degenerate/modified bases or extensive adaptation of PCR conditions, can prove helpful in specific situations, but these strategies often require a lot of time-consuming optimization and can result in unwanted side effects (eg, increased primer-dimer formation). Quantitative data on the effects of 3′ end mismatches is necessary to improve knowledge and reliable prediction of mismatch behavior, which is beneficial for the development and optimization of real-time PCR assays involving mismatches.Several studies on the effects of 3′ end primer-template mismatches have been published.^{9,10,19,20,21,22} However, only few systematically examined the behavior of 3′ end primer-template mismatches (including the relationship between these effects and the position of the mismatch) using modern quantitative methods. In this study, we comprehensively investigate the effects of 3′ end primer-template mismatches using different commercially available 5′-nuclease assay master mixes. Diagnostic laboratories often employ such optimized pre-mixed reagents, which are generally directly used with few adaptations. Our approach therefore provides a relevant system for quantification of mismatch impact on diagnostic real-time PCR assays. Our experiments resulted in a large quantitative dataset from which different aspects of mismatch effects on PCR amplification were further analyzed, ultimately leading to the formulation of a set of general guidelines for improved prediction of primer-template mismatch impact.     

Comparative Biochemical and Computational Study of the Role of Naturally Occurring Mutations at Ambler Positions 104 and 170 in GES β-Lactamases

In GES-type β-lactamases, positions 104 and 170 are occupied by Glu or Lys and by Gly, Asn, or Ser, respectively. Previous studies have indicated an important role of these amino acids in the interaction with β-lactams, although their precise role, especially that of residue 104, remains uncertain. In this study, we constructed GES-1 (Glu104, Gly170), GES-2 (Glu104, Asn170), GES-5 (Glu104, Ser170), GES-6 (Lys104, Ser170), GES-7 (Lys104, Gly170), and GES-13 (Lys104, Asn170) by site-specific mutagenesis and compared their hydrolytic properties. Isogenic comparisons of β-lactam resistance levels conferred by these GES variants were also performed. Data indicated the following patterns: (i) Lys104-containing enzymes exhibited enhanced hydrolysis of oxyimino-cephalosporins and reduced efficiency against imipenem in relation to enzymes possessing Glu104, (ii) Asn170-containing enzymes showed reduced hydrolysis rates of penicillins and older cephalosporins, (iii) Ser170 enabled GES to hydrolyze cefoxitin efficiently, and (iv) Asn170 and Ser170 increased the carbapenemase character of GES enzymes but reduced their activity against ceftazidime. Molecular dynamic simulations of GES apoenzyme models, as well as construction of GES structures complexed with cefoxitin and an achiral ceftazidime-like boronic acid, provided insights into the catalytic behavior of the studied mutants. There were indications that an increased stability of the hydrogen bonding network of Glu166-Lys73-Ser70 and an altered positioning of Trp105 correlated with the substrate spectra, especially with acylation of GES by imipenem. Furthermore, likely effects of Ser170 on GES interactions with cefoxitin and of Lys104 on interactions with oxyimino-cephalosporins were revealed. Overall, the data unveiled the importance of residues 104 and 170 in the function of GES enzymes.GES β-lactamases (GES-1 to GES-16) (www.lahey.org/studies/) comprise a distinct group of molecular class A enzymes with extended-spectrum properties differing by one to three amino acid residues. The respective genes, whose origin(s) remains unknown, occur exclusively in the form of cassettes carried by class 1 integrons identified in both chromosomes (mostly in Pseudomonas aeruginosa) and plasmids (mostly in Klebsiella pneumoniae) (18, 19). GES-producing microorganisms have emerged in many geographic areas. Nevertheless, their incidence so far remains relatively low, and therefore their clinical significance is limited. On the other hand, GES enzymes have caught considerable attention due to their ability to interact with carbapenems and, in the cases of GES-2, -4, -5, and -6, to hydrolyze imipenem at measurable rates (1, 18, 26, 27). The latter β-lactamases possess either Asn (GES-2) or Ser (GES-4, GES-5, and GES-6) at Ambler position 170, while in the remaining GES variants the respective residue is Gly. Another difference common among GES enzymes occurs at position 104, which is occupied by Lys in GES-3, GES-4, GES-6, GES-7, and GES-13, instead of Glu, which is found in the remaining variants (7, 10, 26, 27, 28). The presence of Lys-104 has been associated with increased activity against oxyimino-β-lactams, mainly ceftazidime and aztreonam (7, 10).Determination of the crystal structure of GES-1 has provided useful clues to the configuration of the active site and the catalytic mechanism (23). Nevertheless, the functions of various amino acid residues implicated in β-lactam hydrolysis remain uncertain. As pointed out by Smith et al. (23), comparison of the published kinetic constants of the GES enzymes poses difficulties, partly due to differences in methodologies used. In this study, we compared the hydrolysis spectra, obtained under similar conditions, of six laboratory-constructed GES variants differing at positions 104 and/or 170 (Table ​(Table1).1). We also attempted to gain insights into the functional roles of the respective residues by molecular simulations.

TABLE 1.

Studied GES variants differing from GES-1 by one or two residues at Ambler positions 104 and 170

Genome Analysis of Kingella kingae Strain KWG1 Reveals How a β-Lactamase Gene Inserted in the Chromosome of This Species

We describe the genome of a penicillinase-producing Kingella kingae strain (KWG1), the first to be isolated in continental Europe, whose bla_TEM-1 gene was, for the first time in this species, found to be chromosomally inserted. The bla_TEM gene is located in an integrative and conjugative element (ICE) inserted in Met-tRNA and comprising genes that encode resistance to sulfonamides, streptomycin, and tetracycline. This ICE is homologous to resistance-conferring plasmids of K. kingae and other Gram-negative bacteria.     

Functional gastrointestinal disorders in children: Effectivity,safety, and tolerability of the herbal preparation STW-5 (Iberogast®) in general practice

BackgroundFunctional gastrointestinal disorders (FGIDs) of the upper and lower digestive system in children and adolescents present with heterogeneous gastrointestinal symptoms and are a common reason for specialist consultations. The herbal medicinal preparation STW-5 has already shown efficacy and safety in clinical studies with more than 7000 adult participants suffering from functional dyspepsia (FD) or irritable bowel syndrome (IBS). Here, we evaluate with a prospective observational study the effectivity and safety of STW-5 in children with FGID under real-life conditions and interpret these data versus the background of controlled clinical studies in a predominantly adult population.MethodsThis prospective observational study included 980 children (age 3–14 years) with FGID. For inclusion, Rome III criteria were recommended to apply. The inclusion of the patients for treatment with STW-5 followed routine clinical practice. Patients were treated for approximately 1 week. The presence and severity of symptoms was documented at the study start and at the end of treatment period utilizing the adapted gastrointestinal symptom score (GIS). Other target parameters included global effectivity and tolerability assessments as well as adverse events.ResultsThe average patient age was 7.6 ± 2.9 years. Most of the patients were treated for IBS (n = 418; 43 %) or FD (n = 259; 26 %), with a mean baseline GIS of 16.1 ± 8.9. During the treatment period, the GIS decreased 76 % to 3.8 ± 4.2. The decrease in symptoms was similar for different age groups, gender, and indications. Patients with a shorter duration of complaints had a lower GIS at study end (p < 0.0001. The global treatment effect was assessed as good or very good by 87–89 % of patients/parents and physicians. Physicians rated the global tolerability as good or very good for 95 % of the patients. Seven patients (0.7 %) reported adverse events.ConclusionsThe treatment effect of STW-5 in this study was in its range comparable to according data from controlled clinical trials with predominantly adult participants.Thus, supporting robustness of these data generated in an uncontrolled observational setting. The results of this observational study indicate that STW-5 may be an effective and well tolerated treatment option also for children with FGIDs.     

How and Why Did a Regional Palliative Care Program Lead to Changes in a Region? A Qualitative Analysis of the Japan OPTIM Study

ContextImproving palliative care is one of the major issues throughout the world.ObjectivesThe primary aim of this study was to explore how and why a regional palliative care program led to changes in a region.MethodsAs part of a nationwide mixed-methods study of a regional palliative care program, a qualitative study was performed with 101 health care professionals involved in the implementation of the program. In-depth interviews were done, focusing on perceived changes and the perceived reasons for the changes. We used thematic analyses.ResultsSeven themes were identified as follows: 1) improved communication and cooperation among regional health care professionals; 2) increased confidence in the system to care for cancer patients at home; 3) improved knowledge/skills, practice, and perception of palliative care; 4) contribution to self-growth; 5) wide variability in perceived changes in the knowledge and perception of patients, family members, and the general public; 6) wide variability in the perceived regionwide effects of the project; and 7) unresolved issues. Participants emphasized improved communication and cooperation among regional health care professionals and stated a variety of ways of how communication and cooperation influenced daily practice. The main reasons for changes included regionwide interdisciplinary conferences and informal interactions at a variety of meetings.ConclusionThis study advances understanding of how the regional palliative care program created a change in the region. The findings are useful for developing a conceptual framework and identifying key interventions to improve regional palliative care for clinicians, researchers, and policy makers.     

Longitudinal In Vivo Monitoring of the CNS Demonstrates the Efficacy of Gene Therapy in a Sheep Model of CLN5 Batten Disease

1. Download high-res image (234KB)
2. Download full-size image

     

Comparative Effectiveness of Traditional Chinese Medicine and Psychosocial Care in the Treatment of Temporomandibular Disorders–Associated Chronic Facial Pain

This dual-site study sought to identify the appropriate role for traditional Chinese medicine (TCM; acupuncture and herbs) in conjunction with a validated psychosocial self-care (SC) intervention for treating chronic temporomandibular disorders (TMD)-associated pain. Participants with Research Diagnostic Criteria for Temporomandibular Disorders–confirmed TMD (n = 168) entered a stepped-care protocol that began with a basic TMD class. At weeks 2 and 10, patients receiving SC whose worst facial pain was above predetermined levels were reallocated by minimization to SC or TCM with experienced practitioners. Characteristic facial pain (CFP: mean of worst pain, average pain when having pain, and current pain; each visual analog scale [VAS] 0–10) was the primary outcome. Social activity interference (VAS 0–10) was a secondary outcome. Patients were monitored for safety. TCM provided significantly greater short-term (8-week) relief than SC (CFP reduction difference, −.60 [standard deviation of the estimate .26], P = .020) and greater reduction in interference with social activities (−.81 [standard deviation of the estimate .33], P = .016). In 2 of 5 treatment trajectory groups, more than two thirds of participants demonstrated clinically meaningful responses (≥30% improvement) in pain interference over 16 weeks. This study provides evidence that TMD patients referred for TCM in a community-based model will receive safe treatment that is likely to provide some short-term pain relief and improved quality of life. Similar designs may also apply to evaluations of other kinds of chronic pain. (ClinicalTrials.gov number NCT00856167).