Genetic variations and haplotypes of UGT1A4 in a Japanese population

Nineteen genetic variations, including 11 novel ones, were found in exon 1 and its flanking region of the UDP-glucuronosyltransferase (UGT) 1A4 gene from 256 Japanese subjects, consisting of 60 healthy volunteers, 88 cancer patients and 108 arrhythmic patients. These variations include -217T>G and -36G>A in the 5'-flanking region, 30G>A (P10P), 127delA (43fsX22; frame-shift from codon 43 resulting in the termination at the 22nd codon, codon 65), 175delG (59fsX6), 271C>T (R91C), 325A>G (R109G), and 357T>C (N119N) in exon 1, and IVS1+1G>T, IVS1+98A>G and IVS1+101G>T in the following intron. Among them, 127delA and 175delG can confer early termination of translation, resulting in an immature protein that probably lacks enzymatic activity. Variation IVS1+1G>T is located at a splice donor site and thus may lead to aberrant splicing. Since we did not find any significant differences in the frequencies of all the variations among the three subject groups, the data were analyzed as one group. The allele frequencies of the novel variations were 0.006 for IVS1+101G>T, 0.004 for 30G>A (P10P) and 357T>C (N119N), and 0.002 for the 8 other variations. In addition, the two known nonsynonymous single nucleotide polymorphisms (SNPs), 31C>T (R11W) and 142T>G (L48V), were found at 0.012 and 0.129 frequencies, respectively. The SNP 70C>A (P24T), mostly linked with 142T>G (L48V) in German Caucasians, was not detected in this study. Sixteen haplotypes were identified or inferred, and some haplotypes were confirmed by cloning and sequencing. It was shown that most of 142T>G (L48V) was linked with -219C>T, -163G>A, 448T>C (L150L), 804G>A (P268P), and IVS1+43C>T, comprising haplotype *3a; haplotype *4a harbors 31C>T (R11W); 127delA (43fsX22) and 142T>G (L48V) were linked (haplotype *5a); 175delG (59fsX6) was linked with 325A>G (R109G) (*6a haplotype); and -219C>T, -163G>A, 142T>G (L48V), 271C>T (R91C), 448T>C (L150L), 804G>A (P268P), and IVS1+43C>T comprised haplotype *7a. Our results provide fundamental and useful information for genotyping UGT1A4 in the Japanese and probably Asian populations.     

Genetic variations and haplotypes of CYP2C19 in a Japanese population

Forty-eight single nucleotide variations, including 27 novel ones, were found in the 5'- regulatory region, all of the exons and their surrounding introns of CYP2C19 in 253 Japanese subjects (134 diabetic patients and 119 healthy volunteers). Identified novel variations were as follows: -2772G>A, 2767_-2760delGGTGAACA, -2720T>C, -2547delG, -2545G>T, -2545_-2544 delGC, and -2040C>T in the enhancer region; -778C>T, -777G>A, -529G>C, -189C>A, and -185A>G in the promoter region; 151A>G (S51G), 481G>C (A161P), 986G>A (R329H), 1078G>A (D360N), and 1119C>T (D373D) in the exons, and IVS1+128T>A, IVS3+163G>A, IVS4+271A>G, IVS5-49A>G, IVS6-210C>T, IVS6-196T>A, IVS6-32T>A, IVS7+84G>A, IVS7-174C>T, and IVS8+64C>T in the introns. Since we found no significant differences in the variation frequencies between healthy volunteers and diabetic patients, the data for all subjects were treated as one group in further analysis. The allele frequencies were 0.265 for IVS6-196T>A, 0.045 for -2772G>A and -2720T>C, 0.024 for -2040C>T, 0.014 for IVS7-174C>T, 0.010 for -529G>C, 0.006 for IVS1+128T>A and 481G>C (A161P), 0.004 for -2767_-2760delGGTGAACA and IVS6-210C>T, and 0.002 for the other 17 variations. In addition, the two known nonsynonymous single nucleotide polymorphisms, 681G>A (splicing defect, (*)2 allele) and 636G>A (W212X; (*)3 allele) were detected at 0.267 and 0.128 frequencies, respectively. No variation was detected in the known binding sites for constitutive androstane receptor and glucocorticoid receptor. Linkage disequilibrium analysis showed several close linkages of variations throughout the gene. By using the variations, thirty-one haplotypes of CYP2C19 and their frequencies were estimated. Our results would provide fundamental and useful information for genotyping CYP2C19 in the Japanese and probably other Asian populations.     

Twenty novel genetic variations and haplotype structures of the DCK gene encoding human deoxycytidine kinase (dCK)

Deoxycytidine kinase (dCK) is a rate-limiting enzyme in the activation of nucleoside anticancer drugs, such as gemcitabine and cytarabine (Ara-C), to their active metabolites. In this study, the 5'-flanking region, 7 exons and their flanking introns of DCK were comprehensively screened for genetic variations in 256 Japanese cancer patients administered gemcitabine. Twenty-nine genetic variations, including twenty novel ones, were found: 11 in the 5'-flanking region, 1 in the 5'-untranslated region (UTR), 1 in the coding exon, 9 in the 3'-UTR, and 7 in the introns. The novel variations included -1110C>T, -757G>A, -639C>T, -465G>A, -402T>C, -224C>A, -199C>G, IVS1+38G>T, IVS2+78_+83delTTTTTC, IVS3-9C>T, IVS4+12T>C, IVS5+39T>C, 1357A>G, 1545A>T, 1572delA, 1736G>A, 1749G>A, 1838T>C, 1889G>A, and 2048A>T. The frequencies were 0.01 for IVS2+78_ +83delTTTTTC, 0.008 for -402T>C, 0.006 for -639C>T and IVS4+12T>C, 0.004 for -757G>A and 1572delA, and 0.002 for the other 14 variations. A known nonsynonymous SNP 364C>T (Pro122Ser) was detected at a 0.061 frequency. Using the detected polymorphisms, linkage disequilibrium analysis was performed, and 24 haplotypes were identified or inferred. Our findings suggest considerable ethnic differences in genetic variations of DCK and provide fundamental and useful information for genotyping DCK in the Japanese and probably other Asian populations.     

Seven novel single nucleotide polymorphisms in the human SLC22A1 gene encoding organic cation transporter 1 (OCT1)

Twenty genetic variations, including seven novel ones, were found in the human SLC22A1 gene, which encodes organic cation transporter 1, from 116 Japanese individuals. The novel variations were as follows: -94C>A in the 5'-untranslated region (A of the translation start codon is numbered +1 in the cDNA sequence; MPJ6_OC1001), 350C>T (MPJ6_OC1004), IVS1-35T>C (MPJ6_OC1006), 561G>A (MPJ6_OC1010), IVS6+75C>G (MPJ6_OC1014), IVS8+108A>G (MPJ6_OC1017), and 1671_1673delATG (MPJ6_OC1020). The frequencies were 0.082 for IVS1-35T>C, 0.022 for IVS6+75C>G, 0.009 for 561G>A, and 0.004 for the other 4 variations. Among them, 350C>T resulted in the amino acid substitution Pro117Leu, which is located in the large extracellular loop between transmembrane domains 1 and 2. Also, we detected the four previously reported nonsynonymous variations, 123C>G (Phe41Leu), 480C>G (Phe160Leu), 1022C>T (Pro341Leu), and 1222A>G (Met408Val) with frequencies of 0.004, 0.086, 0.168, and 0.810, respectively.     

Three novel single nucleotide polymorphisms of the human thiopurine S-methyltransferase gene in Japanese individuals

In this study, the entire coding sequence and the exon-intron junctions of the thiopurine S-methyltransferase (TPMT) gene from 200 Japanese individuals were screened for mutation. Three novel single nucleotide polymorphisms (SNPs) were identified-106G>A in exon 3 (Gly36Ser, *20 allele), 967A>G in 3'-untranslated region, and -87C>T in intron 8. The allele frequencies were 0.003 for 106G>A, 0.003 for 967A>G, and 0.010 for IVS8 -87C>T. In addition, the three known SNPs, 474T>C (Ile158Ile), 719A>G (Tyr240Cys, *3C allele), and IVS4 +35C>T were detected at frequencies of 0.299, 0.010, and 0.421, respectively.     

Thirty novel genetic variations in the SLC29A1 gene encoding human equilibrative nucleoside transporter 1 (hENT1)

Thirty-nine genetic variations, including thirty novel ones, were found in the human SLC29A1 gene, which encodes equilibrative nucleoside transporter 1, from 256 Japanese cancer patients administered gemcitabine. The found novel variations included -8,166G>A, -81,10A>G, -7,947G>A, -7,789T>C, -5,595G>A, -3,803_-3,783delTCGGGGAGGTGGCAGTGGGCG, -3,548G>C, -3,414G>A, -1355T>C, -34C>G, IVS1+141G>A, IVS1+260C>T, IVS1-82C>T, 177C>G, IVS3-6C>T, 564C>T, IVS8+44T>C, IVS8+90T>C, IVS8+97T>C, IVS8+131C>T, IVS8+169G>A, 933T>C, 954C>T, IVS11-52G>C, IVS11-46G>A, 1,288G>A, 1,641C>G, 1,703_1,704delGT, 1812C>T, and 1861C>T. The frequencies were 0.051 for IVS8+169G>A, 0.012 for -7,947G>A, 0.006 for IVS1+141G>A and 1,703_1,704delGT, 0.004 for -8,166G>A, -8,110A>G, -3,548G>C, -1,355T>C, -34C>G, IVS8+44T>C, and 1,812C>T, and 0.002 for the other 19 variations. Among them, 177C>G and 1,288G>A resulted in amino acid substitutions Asp59Glu and Ala430Thr, respectively. Using the detected polymorphisms, linkage disequilibrium analysis was performed, and 28 haplotypes were identified or inferred. Our findings would provide fundamental and useful information for genotyping SLC29A1 in the Japanese and probably other Asian populations.     

Fourteen novel single nucleotide polymorphisms in the SLC22A2 gene encoding human organic cation transporter (OCT2)

Thirty-three genetic variations including fourteen novel ones were found in the SLC22A2 gene from 116 Japanese individuals. The novel variations were as follows: 596C>T (MPJ6_OC2003), 602C>T (MPJ6_OC2004), IVS5+20A>G (MPJ6_OC2010), IVS5-84_-83insG (MPJ6_OC2013), IVS6+30T>C (MPJ6_OC2014), IVS6+146G>T (MPJ6_OC2016), IVS6+179G>T (MPJ6_OC2017), IVS6-16delT (MPJ6_OC2018), 1920G>A (MPJ6_OC2022), 2153G>A (MPJ6_OC2026), 2157C>T (MPJ6_OC2028), 2306T>C (MPJ6_OC2031), 2342+5T>C (the last nucleotide number of mRNA+the position in the 3'-flanking region; MPJ6_OC2032) and 2342+127T>C (MPJ6_OC2033). Six variations were located in the exons, four of which were in the 3'-untranslated region (3'-UTR) of exon 11; six were in the introns; and two were in the 3'-flanking region. The frequencies were 0.802 for IVS5-84_-83insG, 0.013 for 602C>T, 0.009 for 596C>T, and 0.004 for the other 11 variations. Among them, 596C>T and 602C>T resulted in amino acid substitutions (Thr199Ile and Thr201Met, respectively).     

Novel nonsynonymous single nucleotide polymorphisms in the CYP2D6 gene

Cytochrome P450 (CYP) 2D6 is an important drug-metabolizing enzyme, and its gene is known to be highly polymorphic. Here, we report five novel nonsynonymous single nucleotide polymorphisms (SNPs), and 65 other sequence variations detected from the gene coding for cytochrome P450 (CYP) 2D6 in 254 Japanese subjects. Two of the novel nonsynonymous SNPs were associated with the *10 key SNP, C100T. Among the 65 variations, 23 were novel, including 12 SNPs in 5'-flanking, 1 in 5'-untranslated, and 10 in intronic regions. The nonsynonymous SNPs in the CYP2D6 gene were as follows: 73 C>T (Arg25Trp, exon 1), 972 C>T (Ala90Val, exon 2), 1611 T>A (Phe120Ile, exon 3), 1720 A>C (Glu156Ala, exon 3), 3172 A>C (Glu334Ala, exon 7). The SNPs, 73C>T, 972 C>T, 1611 T>A, 1720 A>C and 3172 A>C were linked with *10, *1, *10, *1 and *2, respectively.     

Novel genetic variations and haplotypes of hepatocyte nuclear factor 4alpha (HNF4A) found in Japanese type II diabetic patients

Thirty-nine single nucleotide variations, including 16 novel ones, were found in the 5' promoter region, all of the exons and their surrounding introns of HNF4A in 74 Japanese type II diabetic patients. The following novel variations were identified (based on the amino acid numbering of splicing variant 2): -208G>C in the 5' promoter region; 1154C>T (A385V) and 1193T>C (M398T) in the coding exons; 1580G>A, 1852G>T, 2180C>T, 2190G>A, and 2362_2380delAAGAATGGTGTGGGAGAGG in the 3'-untranslated region, and IVS1+231G>A, IVS2-83C>T, IVS3+50C>T, IVS3-54delC, IVS5+173_176delTTAG, IVS5-181_-180delAT, IVS8-106A>G, and IVS9-151A>C in the introns. The allele frequencies were 0.311 for 2362_2380delAAGAATGGTGTGGGAGAGG, 0.054 for 1580G>A, 0.047 for 1852G>T, 0.020 for IVS1+231G>A, 0.014 for IVS9-151A>C, and 0.007 for the other 11 variations. In addition, one known nonsynonymous single nucleotide polymorphism, 416C>T (T139I), was detected at a 0.007 frequency. Based on the linkage disequilibrium profiles, the region analyzed was divided into three blocks. Haplotype analysis determined/inferred 10, 16, and 12 haplotypes for block 1, 2, and 3, respectively. Our results on HNF4A variations and haplotypes would be useful for pharmacogenetic studies in Japanese.     

Genetic variations and frequencies of major haplotypes in SLCO1B1 encoding the transporter OATP1B1 in Japanese subjects: SLCO1B1*17 is more prevalent than *15

A liver-specific transporter organic anion transporting polypeptide 1B1 (OATP1B1, also known as OATP-C) is encoded by SLCO1B1 and mediates uptake of various endogenous and exogenous compounds from blood into hepatocytes. In this study, 15 SLCO1B1 exons (including non-coding exon 1) and their flanking introns were comprehensively screened for genetic variations in 177 Japanese subjects. Sixty-two genetic variations, including 28 novel ones, were found: 7 in the 5'-flanking region, 1 in the 5'-untranslated region (UTR), 13 in the coding exons (9 nonsynonymous and 4 synonymous variations), 5 in the 3'-UTR, and 36 in the introns. Five novel nonsynonymous variations, 311T>A (Met104Lys), 509T>C (Met170Thr), 601A>G (Lys201Glu), 1553C>T (Ser518Leu), and 1738C>T (Arg580Stop), were found as heterozygotes. The allele frequencies were 0.008 for 1738C>T (Arg580Stop) and 0.003 for the four other variations. Arg580Stop having a stop codon at codon 580 results in loss of half of transmembrane domain (TMD) 11, TMD12, and a cytoplasmic tail, which might affect transport activity. In addition, novel variations, IVS12-1G>T at the splice acceptor site and -3A>C in the Kozak motif, were detected at 0.003 and 0.014 frequencies, respectively. Haplotype analysis using -11187G>A, -3A>C, IVS12-1G>T and 9 nonsynonymous variations revealed that the haplotype frequencies for (*)1b, (*)5, (*)15, and (*)17 were 0.469, 0.000 (not detected), 0.037, and 0.133, respectively. These data would provide fundamental and useful information for pharmacogenetic studies on OATP1B1-transported drugs in Japanese.     

Fourteen novel genetic variations and haplotype structures of the TYMS gene encoding human thymidylate synthase (TS)

Forty genetic variations including 14 novel ones were found in the human TYMS gene, which encodes thymidylate synthase, in 263 Japanese cancer patients who received 5-fluorouracil (FU)-based chemotherapy. Three novel variations were located within the 28-bp tandem repeat sequence in the 5'-untranslated region (UTR) and were designated 5Rc, 3Rc-ins and 4Rc. Allele frequencies were 0.021 for 5Rc, 0.006 for 3Rc-ins and 0.002 for 4Rc. Other novel variations included -133G>C and -125G>C in the 5'-UTR; IVS1-278G>A, IVS2-68C>T, IVS2-23T>C, IVS4+122_+123insATTG, IVS4-141G>A, IVS5-100A>T and IVS6-111G>A in the introns; and 1244(*302)A>G and 1264(*322)G>A in the 3'-UTR. The allele frequencies were 0.34 for IVS4+122_+123insATTG, 0.042 for -133G>C, 0.011 for IVS4-141G>A, 0.006 for -125G>C, 0.004 for IVS1-278G>A, IVS2-68C>T, 1244(*302)A>G and 1264(*322)G>A, and 0.002 for IVS2-23T>C, IVS5-100A>T and IVS6-111G>A. Using the detected polymorphisms, linkage disequilibrium (LD) analysis was performed, which divided the TYMS gene into three LD blocks. The 28-bp tandem repeat sequence in the 5'-UTR was assigned as Block 2 with a total of 7 alleles. In Blocks 1 and 3, 7 and 19 haplotypes were determined/inferred, respectively. Our findings provide fundamental and useful information for genotyping TYMS in the Japanese and probably other Asian populations.     

Single nucleotide polymorphisms of ABCB1 (MDR1) gene and distinct haplotype profile in a West Black African population

Objective The ABCB1 (MDR1) multidrug transporter plays a key role in determining drug bioavailability. Differences in drug response exist among different ethnic groups. However, until now, no haplotype data are available in a Black African population.Methods Exons 2, 7, 10, 11, 12, 14, 17, 21, 26, and the surrounding intronic regions were sequenced using genomic DNA from 111 Beninese subjects to examine 19 intragenic single nucleotide polymorphisms (SNPs). Linkage disequilibrium analysis and haplotypes were generated using the expectation–maximization algorithm.Results We identified 12 SNPs, 3 of which were novel: IVS9-57delA, IVS9-8T>A, 1662G>C (exon 14). The most common SNP was IVS14+38A>G. At the MRD1 locus, 53 haplotypes were inferred from the SNP data sets. The 4 SNPs, IVS6+139C>T, IVS9-44A>G, 1236C>T, and 3435C>T, showed strong linkage disequilibrium with each other, confirming the block concept. Moreover, our findings suggest that ABCB1 exonic SNPs are less frequently observed in our population than in African-Americans.Conclusion Our data are compatible with a close evolutionary relationship in Black Africans from Benin.     

Novel single nucleotide polymorphism of UGT1A9 gene in Japanese

We sequenced from 5'-franking region to intron 1 (to 337 bp downstream from exon 1) of the UDP-glucuronosyltransferase (UGT) 1A9 gene prepared from 55 Japanese cancer patients. Seven single nucleotide polymorphisms (SNPs) were found. Two of them were UGT1A9 -118(T)n (n=10) and UGT1A9*5, and four were reported SNPs in intron 1 of UGT1A9 gene (89540C>T, 89549G>A, 89616T>A and 89710A>C). A novel SNP (89587T>C) was found. The sequence is as follows: SNP, 050824FujitaK001; Gene Name, UGT1A9; Accession Number, AF297093; Length, 25 bases; 5'-CCTTCTTGAAGAT/CATGTATTTATAA-3'. Two patients were heterozygous for the mutant allele, resulting in the allele frequency of 1.82%.     

Three novel single nucleotide polymorphisms (SNPs) of CYP2S1 gene in Japanese individuals

We analyzed all nine exons and exon-intron junctions of the CYP2S1 gene in 200 Japanese individuals and identified the following three novel single nucleotide polymorphisms (SNPs): 4612G>A (Glu147Glu) in exon 3, 5478C>T (Leu230Leu) and 5479T>G (Leu230Arg, CYP2S1*5A) in exon 5. The allele frequencies were 0.013 for 4612G>A, 0.058 for 5478C>T, and 0.003 for 5479T>G. In addition, a known SNP 1324C>G (Pro74Pro) was detected at a frequency of 0.300.     

Eight novel single nucleotide polymorphisms in ABCG2/BCRP in Japanese cancer patients administered irinotacan

Eight novel single nucleotide polymorphisms (SNPs) were found in the gene encoding the ATP-binding cassette transporter, ABCG2/BCRP, from 60 Japanese individuals administered the anti-cancer drug irinotecan. The detected SNPs were as follows: 1) SNP, MPJ6_AG2005 (IVS2-93T>C); Gene Name, ABCG2; Accession Number, NT_006204; 2) SNP, MPJ6_AG2007 (IVS3+71_72 insT); Gene Name, ABCG2; Accession Number, NT_006204; 3) SNP, MPJ6_AG2012 (IVS6-204C>T); Gene Name, ABCG2; Accession Number, NT_006204; 4) SNP, MPJ6_AG2015 (at nucleotide 1098G>A (exon 9) from the A of the translation initiation codon); Gene Name, ABCG2; Accession Number, NT_006204; 5) SNP, MPJ6_AG2017 (1291T>C (exon 11)); Gene Name, ABCG2; Accession Number, NT_006204; 6) SNP, MPJ6_AG2019 (IVS11-135G>A); Gene Name, ABCG2; Accession Number, NT_006204; 7) SNP, MPJ6_AG2020 (1465T>C (exon 12)); Gene Name, ABCG2; Accession Number, NT_006204; 8) SNP, MPJ6_AG2023 (IVS13+65T>G); Gene Name, ABCG2; Accession Number, NT_006204.MPJ6_AG2015 was a synonymous SNP (E366E). MPJ6_AG2017 and MPJ6_AG2020 resulted in amino acid alterations, F431L and F489L, respectively.     

Genetic polymorphism of bile acid CoA: amino acid N-acyltransferase in Japanese individuals

In the present study, we identified three novel single nucleotide polymorphisms (SNPs), 147C>T in exon 2 (silent), 602G>C in exon 3 (Arg201Pro), and 1134C>T in exon 4 (silent), in the gene of bile acid CoA: amino acid N-acyltransferase (BAAT) by resequencing the entire coding region and the exon-intron junctions of 100 Japanese individuals. The allelic frequencies were 0.005 for 147C>T, 0.095 for 602G>C, and 0.015 for 1134C>T. The two known SNPs, 59G>A (Arg20Gln, rs1572983) and UTR1513G>A (rs2229594), were detected at a frequency of 0.500 and 0.425, respectively. In the haplotype analysis for the 59G>A and 602G>C polymorphisms, the allelic frequency of 59G-602G, 59G-602C, 59A-602G and 59A-602C was 0.405, 0.095, 0.500 and 0.000, respectively. On the other hand, the allelic frequency of the nonsynonymous SNP 602G>C was 0.194 in a Caucasian population.